P-SETDB1-4
P-SETDB1-4 is a SETDB1 PROTAC degrader with a Kd of 86 nM. P-SETDB1-4 recruits CRBN to SETDB1, induces proteasome-dependent degradation of SETDB1, and forms a ternary complex with CRBN to achieve targeted degradation. P-SETDB1-4 reduces DNA synthesis. P-SETDB1-4 exhibits anticancer activity against breast cancer. P-SETDB1-4 can be used in breast cancer-related research.
(Pink: SETDB1 Target protein ligand; Blue: Cereblon ligand (HY-W942093); Black: linker).
Nos produits utilisent uniquement pour la recherche. Nous ne vendons pas aux patients.
- Formule: C29H36N7O7
- Masse moléculaire:594.64
-
Stockage:
Please store the product under the recommended conditions in the Certificate of Analysis.
Voir tous les produits spécifiques à Isoform PROTACs
MoreVoir tous les produits spécifiques à Isoform Histone Methyltransferase
MoreVoir tous les produits spécifiques à Isoform DNA/RNA Synthesis
More
Activité biologique
P-SETDB1-4 (5 μM; 24-96 h) exhibits good serum stability, with ~40% of the reagent remaining intact after 24 h incubation in 20% fresh serum[1].
P-SETDB1-4 (100 μM) binds purified SETDB1 TTDs with high affinity, exhibiting a Kd of 86 nM[1].
P-SETDB1-4 specifically binds endogenous SETDB1 and CRBN in MCF-7 cell lysates[1].
P-SETDB1-4 (62.5 nM-1000 nM; 2-24 h) induces CRBN- and proteasome-dependent, post-translational degradation of SETDB1 in MCF-7 and T47D breast cancer cells, with substantial degradation observed at 12 h and dose-dependent effects at concentrations ≥500 nM after 24 h[1].
P-SETDB1-4 (1 μM; 24-96 h) significantly reduces the viability of MCF-7 and T47D breast cancer cells after 24-96 h of incubation[1].
P-SETDB1-4 (1 μM; 24 h) decreases DNA synthesis in MCF-7 and T47D breast cancer cells, as shown by reduced EdU-positive cell percentages after 24 h of incubation[1].
P-SETDB1-4 treatment activates the transcriptome and transposable elements (predominantly LTR-type) in MCF-7 breast cancer cells, upregulating genes involved in focal adhesion, cancer pathways, and p53 signaling, including a 2.1-fold increase in CDKN1A and 1.6-fold increase in SNAIL1[1].
MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.
MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.
-
Animal Model:BALB/c athymic nude (female, 4-5 weeks old, subcutaneous xenograft model)[1]
-
Dosage:5 mg/kg
-
Administration:peritumoral injection; on days 10, 12, 14, 15, 16, 17 post-tumor cell injection
-
Result:Reduced final average tumor volume compared to controls.
Reduced final average tumor weight.
Significantly decreased SETDB1 protein levels in tumor tissues.
Reduced Ki-67 expression in tumor tissues.
Caused no significant mouse body weight loss.
Showed no signs of toxicity in major organs (heart, liver, spleen, lung, kidney) via histopathological examination.
Chemical Information
-
Masse moléculaire 594.64
-
Formule C29H36N7O7
-
SMILES
O=C1N(C2CCC(NC2=O)=O)C(C3=C(OCC(NCC4=CN(CCCC(NCCCCCCC[GTTTTGCCGCATAGGATTTTTGGTTGGTCTGGTTGG])=O)N=N4)=O)C=CC=C31)=O
-
Livraison
Room temperature in continental US; may vary elsewhere.
-
Stockage
Please store the product under the recommended conditions in the Certificate of Analysis.
Pureté et documentation
Références
Calculators
Concentration (start) × Volume (start) = Concentration (final) × Volume (final)