2. Search Result
Search Result
Pathways Recommended: Anti-infection
Results for "

chronic HBV infection

" in MedChemExpress (MCE) Product Catalog:

19

Inhibitors & Agonists

3

Inhibitory Antibodies

2

Natural
Products

6

Oligonucleotides

Targets Recommended:
Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-147217
    Bepirovirsen

    ISIS 505358

    		 HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-147217A
    Bepirovirsen sodium

    ISIS 505358 sodium

    		 HBV Infection
    Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-N0444
    Rubiadin

    		Reactive Oxygen Species (ROS) NF-κB HBV Apoptosis Bacterial Fungal Parasite Infection Neurological Disease Metabolic Disease Inflammation/Immunology Cancer
    Rubiadin is an orally active free radical scavenger that inhibits the activation of the NF-κB pathway. Rubiadin inhibits osteoclast formation, bone resorption, lipid peroxidation, HBV DNA replication and cancer cell proliferation; reduces pro-inflammatory cytokine levels; induces cancer cell apoptosis; and possesses antifungal, antimalarial, antibacterial and anticonvulsant activities. Rubiadin can be used in the research of osteoporosis, acute inflammation, chronic inflammation, carbon tetrachloride-induced liver injury, Alzheimer's disease, breast cancer, iron overload disorders, hepatitis B virus infection, colon cancer, liver cancer, T-lymphocytic leukemia, cervical cancer, diabetic nephropathy, epileptic seizures, fungal infections, malaria and bacterial infections .
    Rubiadin
  • HY-145638A
    Xalnesiran sodium

    RO7445482 sodium

    		 HBV Infection
    Xalnesiran (RO7445482) sodium is a small interfering RNA molecule that targets a conserved region of the
    hepatitis B virus (HBV) genome . Xalnesiran sodium can be used for the research of chronic hepatitis B infection .
    Xalnesiran sodium
  • HY-147266
    Elebsiran sodium

    VIR-2218 sodium

    		 Small Interfering RNA (siRNA) HBV Infection
    Elebsiran (VIR-2218) sodium is a siRNA that targets and degrades hepatitis B virus (HBV) and hepatitis D virus (HDV) RNA transcripts. Elebsiran sodium leads to a significant decrease in HBV surface antigen (HBsAg) and a reduction in viral load. Elebsiran sodium binds to the sialic acid-depleted glycoprotein receptor (ASGPR) on the surface of liver cells through the GalNAc ligand, achieving liver-targeted delivery and demonstrating improved liver safety. Elebsiran sodium can be used for the study of chronic HBV/HDV infections .
    Elebsiran sodium
  • HY-W352344
    2'-Deoxy-L-adenosine

    		HBV Infection
    2'-Deoxy-L-adenosine is an orally active synthon for modified oligodeoxyribonucleotides. 2'-Deoxy-L-adenosine is a potent, specific and selective inhibitor of the replication of hepatitis B virus (HBV) as well as the closely related duck and woodchuck hepatitis viruses (WHV) .
    2'-Deoxy-L-adenosine
  • HY-147266A
    Elebsiran

    VIR-2218

    		 HBV Small Interfering RNA (siRNA) Infection
    Elebsiran (VIR-2218) is a siRNA that targets and degrades hepatitis B virus (HBV) and hepatitis D virus (HDV) RNA transcripts. Elebsiran leads to a significant decrease in HBV surface antigen (HBsAg) and a reduction in viral load. Elebsiran binds to the sialic acid-depleted glycoprotein receptor (ASGPR) on the surface of liver cells through the GalNAc ligand, achieving liver-targeted delivery and demonstrating improved liver safety. Elebsiran can be used for the study of chronic HBV/HDV infections .
    Elebsiran
  • HY-145638
    Xalnesiran

    RO7445482

    		 HBV Infection
    Xalnesiran (RO7445482) is a small interfering RNA molecule that targets a conserved region of the
    hepatitis B virus (HBV) genome. Xalnesiran can be used for the research of chronic hepatitis B infection .
    Xalnesiran
  • HY-P99608
    Exbivirumab

    		HBV Infection
    Exbivirumab is a monoclonal antibody directed against highly conserved HBsAg epitopes. Exbivirumab enhances the antiviral activity of hepatitis B immunoglobulin (HBIG). Exbivirumab combined with Libivirumab (HY-P99703) decreases circulating HBsAg and hepatitis B virus (HBV) DNA levels in a chronically infected chimpanzee. Exbivirumab can be used for HBV re-infection in liver transplant .
    Exbivirumab
  • HY-177300
    TLR7/8 agonist 13

    		Toll-like Receptor (TLR) HBV IFNAR Interleukin Related Infection Inflammation/Immunology
    TLR7/8 agonist 13 is an orally active dual agonist of TLR7 (lowest effective concentrations (LEC) [hTLR7] = 1.6 μM) and TLR8 (LEC [hTLR8] = 1.6 μM). TLR7/8 agonist 13 exhibits agonistic activity against human peripheral blood mononuclear cells (hPBMCs) (LEC [hPBMC] = 0.5 μM). TLR7/8 agonist 13 induces endogenous IFNα, activating myeloid dendritic cells and monocytes toward a TH1 phenotype in mice and cynomolgus monkeys. TLR7/8 agonist 13 reduces viral load and HBV surface antigen expression in a mouse model of chronic AAV-HBV infection. TLR7/8 agonist 13 has the potential to indirectly induce IFNγ, which may promote HBV antigen-specific CD8 T cell-mediated responses. TLR7/8 agonist 13 can be used to study hepatitis B virus .
    TLR7/8 agonist 13
  • HY-176059
    HBV-IN-52

    		HBV Infection
    HBV-IN-52 is a selective HBV inhibitor. HBV-IN-52 is a Neplanocin A (HY-130430) derivative that demonstrates significant activity against HBV replication with EC50 = 0.96 μM. HBV-IN-52 can inhibit HBsAg secretion (EC50 = 0.82 μM. HBV-IN-52 can be studied in research for chronic hepatitis B (CHB) infections .
    HBV-IN-52
  • HY-N8168
    LPRP-Et-97543

    		HBV Infection
    LPRP-Et-97543 is a potent anti-HBV agent. LPRP-Et-97543 reduces Core, S, and preS but not X promoter activities. LPRP-Et-97543 can be used for acute and chronic HBV infections research .
    LPRP-Et-97543
  • HY-145713A
    GS-8873 TFA

    HBV-IN-19 TFA

    		 HBV Infection
    GS-8873 TFA is the TFA salt form of GS-8873 (HY-145713). GS-8873 TFA is an orally active inhibitor for the production of hepatitis B virus (HBV) surface antigen (HBsAg) with an EC50 of 4 nM. GS-8873 TFA exhibits good pharmacokinetic characters in rats and metabolic stability in human hepatocytes. GS-8873 TFA causes neurofunctional deficits in rats and cynomolgus monkeys .
    GS-8873 TFA
  • HY-145713
    GS-8873

    HBV-IN-19

    		 HBV Infection
    GS-8873 is an orally active inhibitor for the production of hepatitis B virus (HBV) surface antigen (HBsAg) with an EC50 of 4 nM. GS-8873 exhibits good pharmacokinetic characters in rats and metabolic stability in human hepatocytes. GS-8873 causes neurofunctional deficits in rats and cynomolgus monkeys .
    GS-8873
  • HY-163124
    HBV-IN-43

    		HBV Infection
    HBV-IN-43 (compound 5832) is a potent inhibitor of HBV .
    HBV-IN-43
  • HY-151134
    HBV-IN-25

    		HBV Infection
    HBV-IN-25 is a good potency, orally active novel HBV cccDNA reducer. HBV-IN-25 has anti-HBeAg potency and anti-HBV activity with IC50 values of 0.58 μM and 1.15 μM, respectively. HBV-IN-25 has good aqueous solubility (LYSA＞452 μg/mL) and good PK property with no cellular toxicity .
    HBV-IN-25
  • HY-P992458
    SBT8230

    		Toll-like Receptor (TLR) HBV Infection
    SBT8230 is an ASGR1-targeted TLR8 agonist and an ASGR1-TLR8 immune TAC conjugate. SBT8230 achieves liver enrichment via conjugation with an anti-ASGR1 antibody, activates myeloid cells and induces anti-HBV immune responses. SBT8230 is applicable to research on chronic hepatitis B infection. The corresponding isotype control is: Human lgG1 kappa,lsotype Control (HY-P99001) .
    SBT8230
  • HY-181348
    HBV-IN-56

    		HBV Infection
    HBV-IN-56 is an orally active HBsAg production inhibitor. HBV-IN-56 inhibits HBsAg production both in vitro and in vivo. HBV-IN-56 can be used for the research of chronic hepatitis B virus infection .
    HBV-IN-56
  • HY-108839
    Peginterferon alfa-2a

    Ro 25-8310/000

    		 IFNAR Infection
    Peginterferon alfa-2a is a PEG-modified interferon (IFN) alpha-2a. Peginterferon alfa-2a can be used for research of chronic hepatitis C virus (HCV) and hepatitis B virus (HBV) infection .
    Peginterferon alfa-2a

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

  

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

  

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: