Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
19 Results for "
chronic HBV infection
" in MedChemExpress (MCE) Product Catalog:
Products (19)
19 Results for "chronic HBV infection" in MCE Product Catalog:
Synonyms: ISIS 505358
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
Synonyms: ISIS 505358 sodium
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
Synonyms: RO7445482 sodium
Xalnesiran (RO7445482) sodium is a small interfering RNA molecule that targets a conserved region of the
hepatitis B virus (HBV) genome . Xalnesiran sodium can be used for the research of chronic hepatitis B infection .
hepatitis B virus (HBV) genome . Xalnesiran sodium can be used for the research of chronic hepatitis B infection .
Cat. No.: HY-147266
Purity: 95.83%
Synonyms: VIR-2218 sodium
Target:
Research Areas:
Elebsiran (VIR-2218) sodium is a siRNA that targets and degrades hepatitis B virus (HBV) and hepatitis D virus (HDV) RNA transcripts. Elebsiran sodium leads to a significant decrease in HBV surface antigen (HBsAg) and a reduction in viral load. Elebsiran sodium binds to the sialic acid-depleted glycoprotein receptor (ASGPR) on the surface of liver cells through the GalNAc ligand, achieving liver-targeted delivery and demonstrating improved liver safety. Elebsiran sodium can be used for the study of chronic HBV/HDV infections .
Cat. No.: HY-W352344
CAS No.: 14365-45-8
2'-Deoxy-L-adenosine is an orally active synthon for modified oligodeoxyribonucleotides. 2'-Deoxy-L-adenosine is a potent, specific and selective inhibitor of the replication of hepatitis B virus (HBV) as well as the closely related duck and woodchuck hepatitis viruses (WHV) .
Cat. No.: HY-147266A
CAS No.: 2648009-64-5
Synonyms: VIR-2218
Target:
Research Areas:
Elebsiran (VIR-2218) is a siRNA that targets and degrades hepatitis B virus (HBV) and hepatitis D virus (HDV) RNA transcripts. Elebsiran leads to a significant decrease in HBV surface antigen (HBsAg) and a reduction in viral load. Elebsiran binds to the sialic acid-depleted glycoprotein receptor (ASGPR) on the surface of liver cells through the GalNAc ligand, achieving liver-targeted delivery and demonstrating improved liver safety. Elebsiran can be used for the study of chronic HBV/HDV infections .
Cat. No.: HY-145638
CAS No.: 2538784-48-2
Synonyms: RO7445482
Xalnesiran (RO7445482) is a small interfering RNA molecule that targets a conserved region of the
hepatitis B virus (HBV) genome. Xalnesiran can be used for the research of chronic hepatitis B infection .
hepatitis B virus (HBV) genome. Xalnesiran can be used for the research of chronic hepatitis B infection .
Cat. No.: HY-P99608
CAS No.: 569658-80-6
Cat. No.: HY-177300
CAS No.: 1402802-45-2
Research Areas:
TLR7/8 agonist 13 is an orally active dual agonist of TLR7 (lowest effective concentrations (LEC) [hTLR7] = 1.6 μM) and TLR8 (LEC [hTLR8] = 1.6 μM). TLR7/8 agonist 13 exhibits agonistic activity against human peripheral blood mononuclear cells (hPBMCs) (LEC [hPBMC] = 0.5 μM). TLR7/8 agonist 13 induces endogenous IFNα, activating myeloid dendritic cells and monocytes toward a TH1 phenotype in mice and cynomolgus monkeys. TLR7/8 agonist 13 reduces viral load and HBV surface antigen expression in a mouse model of chronic AAV-HBV infection. TLR7/8 agonist 13 has the potential to indirectly induce IFNγ, which may promote HBV antigen-specific CD8 T cell-mediated responses. TLR7/8 agonist 13 can be used to study hepatitis B virus .
Cat. No.: HY-176059
HBV-IN-52 is a selective HBV inhibitor. HBV-IN-52 is a Neplanocin A (HY-130430) derivative that demonstrates significant activity against HBV replication with EC50 = 0.96 μM. HBV-IN-52 can inhibit HBsAg secretion (EC50 = 0.82 μM. HBV-IN-52 can be studied in research for chronic hepatitis B (CHB) infections .
Cat. No.: HY-N8168
CAS No.: 84638-48-2
Category:
Infection Liliaceae Flavonoids Phenols Polyphenols Plants Disease Research Fields Disporopsis aspera (Hua) Engl. Isoflavones
Target:
Cat. No.: HY-145713
CAS No.: 2241575-59-5
Synonyms: HBV-IN-19
GS-8873 is an orally active inhibitor for the production of hepatitis B virus (HBV) surface antigen (HBsAg) with an EC50 of 4 nM. GS-8873 exhibits good pharmacokinetic characters in rats and metabolic stability in human hepatocytes. GS-8873 causes neurofunctional deficits in rats and cynomolgus monkeys .
Cat. No.: HY-145713A
CAS No.: 2241575-60-8
Synonyms: HBV-IN-19 TFA
GS-8873 TFA is the TFA salt form of GS-8873 (HY-145713). GS-8873 TFA is an orally active inhibitor for the production of hepatitis B virus (HBV) surface antigen (HBsAg) with an EC50 of 4 nM. GS-8873 TFA exhibits good pharmacokinetic characters in rats and metabolic stability in human hepatocytes. GS-8873 TFA causes neurofunctional deficits in rats and cynomolgus monkeys .
Cat. No.: HY-151134
CAS No.: 2161364-69-6
HBV-IN-25 is a good potency, orally active novel HBV cccDNA reducer. HBV-IN-25 has anti-HBeAg potency and anti-HBV activity with IC50 values of 0.58 μM and 1.15 μM, respectively. HBV-IN-25 has good aqueous solubility (LYSA＞452 μg/mL) and good PK property with no cellular toxicity .
Cat. No.: HY-P992458
Target:
Research Areas:
- 1
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
