1. Search Result
Search Result
Pathways Recommended: Anti-infection
Results for "

infection

" in MCE Product Catalog:

5272

Inhibitors & Agonists

18

Screening Libraries

27

Dye Reagents

10

Biochemical Assay Reagents

239

Peptides

10

Inhibitory Antibodies

1164

Natural
Products

539

Isotope-Labeled Compounds

Cat. No. Product Name Target Research Areas
  • HY-145713
    HBV-IN-19

    HBV Infection
    HBV-IN-19 inhibits hepatitis B virus (HBV) infection. Inhibiting HBsAg secretion and/or production is a strategy for the treatment of HBV infection, including chronic HBV infection.
  • HY-145713A
    HBV-IN-19 TFA

    HBV Infection
    HBV-IN-19 TFA inhibits hepatitis B virus (HBV) infection. Inhibiting HBsAg secretion and/or production is a strategy for the treatment of HBV infection, including chronic HBV infection.
  • HY-N7139
    Penicillin G

    Benzylpenicillin

    Antibiotic Infection
    Penicillin G is a potent penicillinantibiotic. Penicillin G can be used for bacterial infection.
  • HY-139755
    Antibacterial agent 38

    Bacterial Infection
    Antibacterial agent 38 is an antibacterial agent extracted from patent WO2015063714A1, compound C. Antibacterial agent 38 can be used for the research of bacterial infections.
  • HY-139754
    Antibacterial agent 37

    Bacterial Infection
    Antibacterial agent 37 is an antibacterial agent extracted from patent WO2015063714A1, compound B. Antibacterial agent 37 can be used for the research of bacterial infections.
  • HY-139761
    Antibacterial agent 44

    Bacterial Infection
    Antibacterial agent 44 is an antibacterial agent extracted from patent WO2013030735A1, example 7. Antibacterial agent 44 can be used for the research of bacterial infections.
  • HY-139763
    Antibacterial agent 46

    Bacterial Infection
    Antibacterial agent 46 is an antibacterial agent extracted from patent WO2013030735A1, example 9. Antibacterial agent 46 can be used for the research of bacterial infections.
  • HY-139760
    Antibacterial agent 43

    Bacterial Infection
    Antibacterial agent 43 is an antibacterial agent extracted from patent WO2013030735A1, example 6. Antibacterial agent 43 can be used for the research of bacterial infections.
  • HY-119900
    Carnidazole

    Parasite Antibiotic Infection
    Carnidazole is an antiprotozoal agent of the nitroimidazole class. Carnidazole is used for the research of Trichomonas infection.
  • HY-106571
    Cefteram pivoxil

    Ro 19-5248; T-2588

    Bacterial Antibiotic Infection
    Cefteram pivoxil (Ro 19-5248), an orally active cephalosporin antibiotic, is used for bacterial infections.
  • HY-A0090
    Nitrofurantoin

    Bacterial Antibiotic Infection
    Nitrofurantoin is a potent and orally active broad-spectrum beta-lactamase antimicrobial agent. Nitrofurantoin acts as an antibiotic and can be used for the study of urinary tract infections (UTIs), including cystitis and kidney infections.
  • HY-W039454
    2,4-Dichlorobenzyl alcohol

    Bacterial Infection
    2,4-Dichlorobenzyl alcohol is a mild antiseptic, with a broad spectrum for bacterial and virus associated with mouth and throat infections.
  • HY-108971
    Demecycline

    Bacterial Infection
    Demecycline, a tetracycline antibiotic, is the C6-demethylated derivative of Tetracycline (HY-A0107) against bacterial infections including pneumonia and other respiratory tract infections.
  • HY-W009886
    3,4,5-Trimethoxybenzaldehyde

    Bacterial Infection
    3,4,5-Trimethoxybenzaldehyde is an intermediate for the synthesis of various pharmaceuticals, especially for trimethoprim used to treat bacterial infections, including urinary tract pathogens infection.
  • HY-B0337A
    Sulfadimethoxine sodium

    Sulphadimethoxine sodium

    Bacterial Antibiotic Infection
    Sulfadimethoxine sodium (Sulphadimethoxine sodium) is a sulfonamide antibiotic used to treat many infections.
  • HY-B0337
    Sulfadimethoxine

    Sulphadimethoxine

    Bacterial Antibiotic Infection
    Sulfadimethoxine (Sulphadimethoxine) is a sulfonamide antibiotic used to treat many infections.
  • HY-B0555B
    Nafcillin sodium

    Antibiotic Infection
    Nafcillin sodium, an antibiotic, is a reversible inhibitor of β-lactamase. Nafcillin sodium can be used for the research of staphylococcal infections.
  • HY-109004
    Enzaplatovir

    BTA-C585

    RSV Infection
    Enzaplatovir (BTA-C585) is an orally bioavailable fusion inhibitor for respiratory syncytial virus (RSV) infection.
  • HY-139751
    β-Lactamase-IN-4

    Bacterial Infection
    β-Lactamase-IN-4 is a β-lactamase inhibitor extracted from patent WO2013149121A1, compound 708. β-Lactamase-IN-4 can be used for the research of bacterial infections.
  • HY-139779
    β-Lactamase-IN-5

    Bacterial Infection
    β-Lactamase-IN-5 is a β-lactamase inhibitor extracted from patent WO2013149121A1, compound 720. β-Lactamase-IN-5 can be used for the research of bacterial infections.
  • HY-131554
    Tibezonium iodide

    Bacterial Antibiotic Infection
    Tibezonium iodide, an oropharyngeal disinfectant, has antibacterial activity for the prevention of mouth infections.
  • HY-119123
    Voxvoganan

    LTX-109

    Fungal Bacterial Infection
    Voxvoganan (LTX-109), a topical antimicrobial, is highly effective against S. aureus with a MIC range of 2 to 4 μg/mL. Voxvoganan can be used for the research of bacterial skin infections, fungal infections and nasal decolonisation of MRSA.
  • HY-A0111
    Cefetamet

    Ro 15-8074; Deacetoxycefotaxime

    Antibiotic Bacterial Infection
    Cefetamet is a cephalosporin antibiotic. Cefetamet has the potential for the research of both upper and lower community-acquired respiratory tract infections.
  • HY-133937
    Sulfametrole

    Bacterial HIV Infection
    Sulfametrole is an orally active and potent antibacterial. Sulfametrole can be used for infections research, such as HIV, severe pneumonia and UTIs (urinary tract infections).
  • HY-108880
    Carindacillin sodium

    Carbenicillin indanyl sodium; CP-15464-2

    Bacterial Infection
    Carindacillin (Carbenicillin indanyl) sodium is an orally active and broad-spectrum antimicrobial agent. Carindacillin sodium can be hydrolyzed to Carbenicillin in vivo. Carindacillin sodium can be used for the research of urinary-tract infection.
  • HY-B0455A
    Lomefloxacin

    SC47111A

    Bacterial Antibiotic Infection
    Lomefloxacin (SC47111A) is a broad-spectrum quinolone antibiotic, with antimicrobial activity. Lomefloxacin is used for the research of respiratory tract infections, genitourinary infections, gastrointestinal infections, ENT infections, etc..
  • HY-B0198A
    Cefaclor monohydrate

    Bacterial Antibiotic Infection
    Cefaclor (monohydrate) is a well-absorbed orally active cephalosporin antibiotic. Cefaclor can specifically bind to specific for penicillin-binding protein 3 (PBP3). Cefaclor can be used for the research kinds of infections caused by bacteria, such as respiratory tract infections, bacterial bronchitis, pharyngitis and skin infections.
  • HY-B0198
    Cefaclor

    Bacterial Antibiotic Infection
    Cefaclor is a well-absorbed orally active cephalosporin antibiotic. Cefaclor can specifically bind to specific for penicillin-binding protein 3 (PBP3). Cefaclor can be used for the research kinds of infections caused by bacteria, such as respiratory tract infections, bacterial bronchitis, pharyngitis and skin infections.
  • HY-132823
    Ledaborbactam

    Bacterial Infection
    Iedaborbactam, as a beta-lactamase inhibitor (WO2015191907, Example 62), can be used for the research of bacterial infections.
  • HY-106296
    WIN 54954

    Enterovirus Infection
    WIN 54954 is an orally active and broad-spectrum antipicornavirus agent. WIN 54954 is effectiveness against human rhinovirus, echovirus 9 and enterovirus infections.
  • HY-B0455
    Lomefloxacin hydrochloride

    SC47111A hydrochloride

    Bacterial Antibiotic Infection
    Lomefloxacin (SC47111A) hydrochloride is a broad-spectrum quinolone antibiotic, with antimicrobial activity. Lomefloxacin hydrochloride is used for the research of respiratory tract infections, genitourinary infections, gastrointestinal infections, ENT infections, etc..
  • HY-B0996
    Hexetidine

    NSC-17764

    Bacterial Fungal Infection
    Hexetidine is an orally active antiseptic with broad antibacterial and antifungal activity. Hexetidine give important potential for treatment of oral infections.
  • HY-117660
    Lincomycin

    U-10149

    Antibiotic Infection
    Lincomycin, a lincosamide antibiotic, is an antimicrobial agent used for the research of Gram-positive bacteria infections.
  • HY-151418
    Chitin synthase inhibitor 8

    Fungal Infection
    Chitin synthase inhibitor 8 is a chitin synthase (CHS) inhibitor with broad-spectrum antifungal activity. Chitin synthase inhibitor 8 can be used in the research of fungi infection.
  • HY-151419
    Chitin synthase inhibitor 9

    Fungal Infection
    Chitin synthase inhibitor 9 is a chitin synthase (CHS) inhibitor with broad-spectrum antifungal activity. Chitin synthase inhibitor 9 can be used in the research of fungi infection.
  • HY-144093
    HPK1-IN-26

    MAP4K Infection
    HPK1-IN-26 is a HPK1 and GLK inhibitor extracted from patent WO2021254118A1 compound 1. HPK1-IN-26 can be used for the research of animal pathogen infection.
  • HY-16472
    Sulfacytine

    Antibiotic Bacterial Infection
    Sulfacytine is a short-acting sulfonamide antibiotic. Sulfacytine is active against bacteria and is an effective drug for the research of acute uncomplicated urinary tract infections.
  • HY-147015
    HOE961

    Orthopoxvirus Infection
    HOE961, the diacetate ester prodrug of S2242, is active against respiratory cowpox virus infections, is orally active in infection models. Anti-orthopoxvirus activity.
  • HY-135117
    Glyceryl monocaprate

    Monocaprin

    Bacterial HSV Infection
    Glyceryl monocaprate (Monolaurin) is a 1-monoglyceride of capric acid against gram-positive bacterial infections. Glyceryl monocaprate (Monolaurin) has inhibitory effect on Herpes Simplex Virus (HSV) and offers an effective treatment for herpes labialiss.
  • HY-17592A
    Bithionol (sulfoxide)

    Parasite Infection
    Bithionol sulfoxide is an anti-infection agent for parasites. Bithionol sulfoxide has mutagenic activity. Bithionol sulfoxide can be used in the research of parasite infection, such as paragonimiasis, flukes andcestodes infection.
  • HY-B0337S1
    Sulfadimethoxine-d6

    Sulphadimethoxine-d6

    Bacterial Antibiotic Infection
    Sulfadimethoxine-d6 (Sulphadimethoxine-d6) is the deuterium labeled Sulfadimethoxine. Sulfadimethoxine is a sulfonamide antibiotic used to treat many infections.
  • HY-132282
    Thiamphenicol glycinate hydrochloride

    Bacterial Infection
    Thiamphenicol glycinate hydrochloride is a broad-spectrum antibacterial agent that can be used for respiratory tract infections research.
  • HY-P3425
    AGPV

    Parasite Infection
    AGPV, a tetrapeptide, has the potential for prevention of schistosome parasite infection research.
  • HY-138502
    Melarsomine

    Parasite Infection
    Melarsomine is a trivalent arsenical compound used as an adulticide. Melarsomine can be used for the reserach of canine heartworm disease and other helminth infections.
  • HY-138502A
    Melarsomine dihydrochloride

    Parasite Infection
    Melarsomine dihydrochloride is a trivalent arsenical compound used as an adulticide. Melarsomine dihydrochloride can be used for the reserach of canine heartworm disease and other helminth infections.
  • HY-P3425A
    AGPV TFA

    Parasite Infection
    AGPV TFA, a tetrapeptide, has the potential for prevention of schistosome parasite infection research.
  • HY-P3417
    Amp1EP9

    Bacterial Infection
    Amp1EP9 is an antimicrobial peptide. Amp1EP9 is a powerful tool for developing potent and nontoxic antimicrobial drugs. Amp1EP9 has the potential for the research of multidrug-resistant bacterial infections.
  • HY-14737
    Ceftaroline fosamil

    TAK-599; PPI0903

    Bacterial Antibiotic Infection
    Ceftaroline fosamil (TAK-599), a cephalosporin derivative, is an N-phosphono prodrug of anti-methicillin-resistant Staphylococcus aureus (MRSA) T-91825. Ceftaroline fosamil can be used for the research of MRSA infection.
  • HY-14738
    Ceftaroline fosamil inner salt

    TAK-599 free acid; PPI0903 free acid

    Bacterial Antibiotic Infection
    Ceftaroline fosamil (TAK-599) inner salt, a cephalosporin derivative, is an N-phosphono prodrug of anti-methicillin-resistant Staphylococcus aureus (MRSA) T-91825. Ceftaroline fosamil inner salt can be used for the research of MRSA infection.
  • HY-145596
    Sirpefenicol

    Bacterial Infection
    Sirpefenicol is a phenicol antibacterial agent. Sirpefenicol can be used in bacterial infections in animals (extracted from patent WO2020068607A1).
  • HY-W013266
    N4-Acetylsulfamethoxazole

    Acetylsulfamethoxazole

    Bacterial Infection Metabolic Disease
    N4-Acetylsulfamethoxazole (Acetylsulfamethoxazole) is a metabolite of Sulfamethoxazole (HY-B0322). Sulfamethoxazole is a sulfonamide bacteriostatic antibiotic, used for bacterial infections.
  • HY-P2292A
    Omiganan-FITC TFA

    Bacterial Fungal Infection
    Omiganan-FITC TFA is a peptide-FITC complex composed of Omiganan and a FITC. Omiganan is a bactericidal and fungicidal cationic peptide being developed as a topical gel for prevention of catheter-associated infections.
  • HY-A0090A
    Nitrofurantoin sodium

    Antibiotic Bacterial Infection
    Nitrofurantoin sodium is a potent and orally active antibacterial agent. Nitrofurantoin sodium acts as an antibiotic. Nitrofurantoin sodium can be used for the study of urinary tract infections (UTIs), including cystitis and kidney infections.
  • HY-130627
    RSV/IAV-IN-2

    RSV Influenza Virus Infection
    RSV/IAV-IN-2 (compound 14c) is a potent and dual inhibitor of RSV/IAV. RSV/IAV-IN-2 has lesser cytotoxicity than the clinical drug, Ribavirin. RSV/IAV-IN-2 has the potential for the research of RSV and/or IAV infections.
  • HY-130626
    RSV/IAV-IN-1

    RSV Influenza Virus Infection
    RSV/IAV-IN-1 (compound 14e) is a potent and dual inhibitor of RSV/IAV. RSV/IAV-IN-1 has lesser cytotoxicity than the clinical drug, Ribavirin. RSV/IAV-IN-1 has the potential for the research of RSV and/or IAV infections.
  • HY-14749A
    Pyronaridine tetraphosphate

    Parasite Infection
    Pyronaridine tetraphosphate is an orally active Mannich base anti-malarial agent. Pyronaridine tetraphosphate is active against P. falciparum and Echinococcus granulosus infection.
  • HY-B0395C
    Sitafloxacin hydrate

    DU6859a hydrate

    Bacterial Antibiotic Infection
    Sitafloxacin (DU6859a) hydrate is a potent, orally active fluoroquinolone antibiotic with in vitro activity against a broad range of gram-positive and gram-negative bacteria, including anaerobic bacteria, as well as against atypical pathogens. Sitafloxacin can be used for the research of respiratory tract infection and urinary tract infection.
  • HY-144108
    HCV-IN-35

    HCV Infection
    HCV-IN-35 (Compound (R)-3h) is a potent inhibitor of HCV. HCV-IN-35 has the potential for the research infection diseases.
  • HY-117411A
    Coblopasvir dihydrochloride

    KW-136 dihydrochloride

    HCV HCV Protease Infection
    Coblopasvir (KW-136) dihydrochloride is a pangenotypic non-structural protein 5A (NS5A) inhibitor. Coblopasvir dihydrochloride can be used for research of chronic hepatitis C virus infection.
  • HY-139554
    Zifanocycline

    KBP-7072

    Bacterial Infection
    Zifanocycline (KBP-7072) is a semisynthetic third-generation aminomethylcycline antibiotic that inhibits the normal function of the bacterial ribosome. Zifanocycline exhibits a broad spectrum of in vitro antibacterial activity against Gram-positive and Gram-negative bacteria, including many multidrug-resistant pathogens. Zifanocycline is available in both oral and injectable formulations. Zifanocycline can be used for the research of acute bacterial skin and skin structure infections, community-acquired bacterial pneumonia, and complicated intra-abdominal infections.
  • HY-B1369
    Imipenem monohydrate

    N-Formimidoyl thienamycin monohydrate; MK0787 monohydrate

    Bacterial Antibiotic Infection
    Imipenem monohydrate, a stable crystalline derivative of thienamycin, is an antibiotic and has the excellent activity against a broad range of gram-positive and gram-negative aerobic and anaerobic bacteria. Imipenem monohydrate can be used for the research of carbapenem-nonsusceptible and P. aeruginosa biofilm infections.
  • HY-B0395A
    Sitafloxacin hydrochloride

    DU6859a hydrochloride

    Antibiotic Bacterial Infection
    Sitafloxacin (DU6859a) hydrochloride is a potent, orally active fluoroquinolone antibiotic. Sitafloxacin hydrochloride shows antichlamydial activity and antibacterial activities against a broad range of gram-positive and gram-negative bacteria, including anaerobic bacteria, as well as against atypical pathogens. Sitafloxacin hydrochloride can be used for the research of respiratory tract infection and urinary tract infection.
  • HY-B0395
    Sitafloxacin

    DU6859a

    Bacterial Antibiotic Infection
    Sitafloxacin (DU6859a) is a potent, orally active fluoroquinolone antibiotic. Sitafloxacin shows antichlamydial activity and antibacterial activities against a broad range of gram-positive and gram-negative bacteria, including anaerobic bacteria, as well as against atypical pathogens. Sitafloxacin can be used for the research of respiratory tract infection and urinary tract infection.
  • HY-P9944
    Palivizumab

    MEDI 493

    RSV Infection
    Palivizumab (MEDI 493), a humanized respiratory syncytial virus monoclonal antibody, reduces respiratory syncytial virus (RSV) infection.
  • HY-151416
    Chitin synthase inhibitor 6

    Fungal Infection
    Chitin synthase inhibitor 6 (compound 9b) is a potent chitin synthase (CHS) inhibitor with an IC50 value of 0.21 mM. Chitin synthase inhibitor 6 has broad-spectrum antifungal activity against drug-resistant fungi. Chitin synthase inhibitor 6 can be used in the research of fungi infection.
  • HY-151417
    Chitin synthase inhibitor 7

    Fungal Infection
    Chitin synthase inhibitor 7 (compound 9c) is a potent chitin synthase (CHS) inhibitor with an IC50 value of 0.37 mM. Chitin synthase inhibitor 7 has broad-spectrum antifungal activity against drug-resistant fungi. Chitin synthase inhibitor 7 can be used in the research of fungi infection.
  • HY-120832
    Azt-pmap

    HIV Infection
    Azt-pmap, a nucleoside analogue, is an aryl phosphate derivative of AZT. Azt-pmap shows anti-HIV activity. AZT is a nucleoside reverse transcriptase inhibitor (NRTI) for HIV infection.
  • HY-B1369A
    Imipenem

    N-Formimidoyl thienamycin; MK0787

    Antibiotic Bacterial Infection
    Imipenem (MK0787), a stable crystalline derivative of thienamycin, is an antibiotic and has the excellent activity against a broad range of gram-positive and gram-negative aerobic and anaerobic bacteria. Imipenem can be used for the research of carbapenem-nonsusceptible and P. aeruginosa biofilm infections.
  • HY-16745
    Lascufloxacin

    KRP-AM1977X

    Bacterial Infection
    Lascufloxacin (KRP-AM1977X) is a potent and orally active fluoroquinolone antibacterial agent. Lascufloxacin potently inhibits infections caused by various pathogens, including quinolone-resistant strains. Lascufloxacin has the potential for various infectious diseases treatment, including lower respiratory tract infections.
  • HY-107798
    Potassium guaiacolsulfonate hemihydrate

    Bacterial Infection
    Potassium guaiacolsulfonate hemihydrate is an orally active expectorant used for acute respiratory tract infections. Potassium guaiacolsulfonate hemihydrate helps loosen mucus and used for a cough caused by the common cold, infections or allergies in combination with other drugs.
  • HY-128036
    ddATP

    2',3'-Dideoxyadenosine 5'-triphosphate

    DNA/RNA Synthesis HIV Infection
    ddATP (2',3'-Dideoxyadenosine 5'-triphosphate), an active metabolite of 2',3'-dideoxyinosine, is a chain-elongating inhibitor of DNA polymerase. ddATP can be used for Sanger method for DNA sequencing and research of virus infection.
  • HY-128036B
    ddATP trisodium

    2',3'-Dideoxyadenosine 5'-triphosphate trisodium

    DNA/RNA Synthesis HIV Infection
    ddATP (2',3'-Dideoxyadenosine 5'-triphosphate) trisodium, an active metabolite of 2',3'-dideoxyinosine, is a chain-elongating inhibitor of DNA polymerase. ddATP trisodium can be used for Sanger method for DNA sequencing and research of virus infection.
  • HY-112542
    Nemadectin

    CL-287088; LL-F28249 α

    Parasite Antibiotic Infection
    Nemadectin (CL-287088), an orally active broad-spectrum endectocide, is highly efficacious against natural infections of all the major canine gastrointestinal helminthes. Anthelmintic activity.
  • HY-17426
    Famciclovir

    BRL 42810

    HSV HBV Infection
    Famciclovir (BRL 42810) is an orally active nucleoside analogue. Famciclovir is an antiviral agent with potent activities against HBV, HSV and VZV. Famciclovir can be used for the research of herpesvirus infection.
  • HY-N10255
    Trypacidin

    Others Infection
    Trypacidin is the conidia-bound metabolite with antiprotozoal activity. Trypacidin has a protective function against phagocytes both in the environment and during the infection process.
  • HY-121513
    Torcitabine

    2'-Deoxy-L-cytidine

    HBV Infection
    Torcitabine (2'-Deoxy-L-cytidine) is an antiviral agent. Torcitabine has the potential for chronic hepatitis B virus infection treatment.
  • HY-122704A
    Surfen dihydrochloride

    Aminoquincarbamide dihydrochloride

    FGFR HSV VEGFR Infection
    Surfen dihydrochloride is a potent HS (heparan sulfate) antagonist. Surfen binds to glycosaminoglycans. Surfen neutralizes the anticoagulant activity of both unfractionated and low molecular weight heparins. Surfen affects sulfation of heparin and inhibits degradation by heparin lyases. Surfen inhibits FGF2 binding and signaling. Surfen inhibits cell attachment, and virus infection.
  • HY-B0213
    Sulfameter

    Sulfametoxydiazine; 5-Methoxysulfadiazine

    Antibiotic Bacterial Infection
    Sulfameter (Sulfametoxydiazine; 5-Methoxysulfadiazine) is an effective long-acting sulfonamide antibiotic with antibacterial activities. Sulfameter can be used for the research of urinary tract infections and lepriasis.
  • HY-B1210
    Pipemidic acid

    Bacterial Antibiotic Infection
    Pipemidic acid, a derivative of Piromidic acid, is an antibacterial agent. Pipemidic acid is active against gram-negative bacteria including Pseudomonas aeruginosa as well as some gram-positive bacteria. Pipemidic acid can be used for the research of intestinal, urinary, and biliary tract infections.
  • HY-N8393
    Ascr#18

    Bacterial Fungal Infection
    Ascr#18, an ascaroside, is a hormone of nematodes. Ascr#18 is expressed during nematode development. Ascr#18 increases resistance in Arabidopsis, tomato, potato and barley to viral, bacterial, oomycete, fungal and nematode infections.
  • HY-124952
    iKIX1

    Fungal Infection
    iKIX1 is an antifungal agent and resensitizes drug-resistant C. glabrata to azole antifungals in vitro. iKIX1 inhibits the interaction between the KIX domain of the mediator subunit CgGal11A and the activation domain of CgPdr1, the IC50 and Ki values are 190.2 μM and 18 μM, respectively. iKIX1 is used for the study of multidrug resistance and C. glabrata infection.
  • HY-B0956
    Paromomycin sulfate

    Aminosidine sulfate

    Antibiotic Parasite Bacterial Infection
    Paromomycin (Aminosidine) sulfate, a neomycin (HY-B0470) derivative, is a broad spectrum aminoglycoside antibiotic with amebicidal and bactericidal effects. Paromomycin sulfate prematures termination of translation of mRNA and inhibits protein synthesis by specifically binds to the RNA oligonucleotide at the A site of bacterial 30S ribosomes. Paromomycin sulfate can be used for the research of bacterial and parasitic infections.
  • HY-116433
    Nequinate

    Parasite Xanthine Oxidase Infection Metabolic Disease
    Nequinate, a quinoline compound, is an anticoccidial agent against cecal coccidiosis (Eimeria tenella) infections. Nequinate inhibits xanthine oxidoreductase (XOD) activity.
  • HY-144820
    JO146

    Ser/Thr Protease Infection
    JO146 is a Chlamydia trachomatis high temperature requirement A (CtHtrA) protease inhibitor with IC50s of 21.86 and 1.15 μM for CtHtrA and human neutrophil elastase (HNE), respectively. JO146 can be used to inhibits bacterial infections.
  • HY-126810A
    NP213 TFA

    Fungal Infection
    NP213 TFA is a rapidly acting, novel, first-in-class synthetic antimicrobial peptide (AMP), has anti-fungal activities. NP213 TFA targets the fungal cytoplasmic membrane and plays it role via membrane perturbation and disruption. NP213 TFA is effective and well-tolerated in resolving nail fungal infections.
  • HY-117411
    Coblopasvir

    KW-136

    HCV HCV Protease Infection Inflammation/Immunology
    Coblopasvir (KW-136) is a pangenotypic non-structural protein 5A (NS5A) inhibitor. Coblopasvir can be used for research of chronic hepatitis C virus infection.
  • HY-126810
    NP213

    Fungal Infection
    NP213 is a rapidly acting, novel, first-in-class synthetic antimicrobial peptide (AMP), has anti-fungal activities. NP213 targets the fungal cytoplasmic membrane and plays it role via membrane perturbation and disruption. NP213 is effective and well-tolerated in resolving nail fungal infections.
  • HY-A0161
    Chlophedianol

    Clofedanol; Calmotusin; NSC 113595

    Others Infection
    Chlophedianol (Clofedanol) is an orally active and potent antitussive agent. Chlophedianol can be used for the research of acute cough due to upper respiratory tract infections (URIs).
  • HY-15993
    Posizolid

    AZD2563; AZD5847

    Antibiotic Infection
    Posizolid (AZD2563), an oxazolidinone antibiotic, is developed by AstraZeneca for the study of bacterial infections. Posizolid shows very good anti-mycobacterial activity.
  • HY-B1267
    Sulfaguanidine

    Bacterial Antibiotic Infection
    Sulfaguanidine is an orally active antimicrobial agent/antibiotic of sulfonamide class. Sulfaguanidine can be used for the research of enteric infections such as bacillary dysentery.
  • HY-W282615
    Antibacterial agent 117

    Bacterial Infection
    Antibacterial agent 117, triazole derivative, is an antibacterial agent. Antibacterial agent 117 has against R. prowazekii MetAP1 (RpMetAP1) activity with an IC50 value of 15 μM. Antibacterial agent 117 also inhibits rickettsial growth and can be used for the research of infection.
  • HY-A0035
    Faropenem

    Antibiotic Infection
    Faropenem is a potent and orally active beta-lactam antibiotic. Faropenem demonstrates broad-spectrum in vitro antimicrobial activity against many gram-positive and -negative aerobes and anaerobes. Faropenem is resistant to hydrolysis by nearly all beta-lactamases, including extended-spectrum beta-lactamases and AmpC beta-lactamases. Faropenem is developed as an oral prodrug, faropenem medoxomil, for the research of respiratory tract infections.
  • HY-B0159
    Balofloxacin

    Q-35

    Bacterial Antibiotic Infection
    Balofloxacin (Q-35) is an orally active fluoroquinolone antibiotic with broad-spectrum antibacterial activity against gram-negative, gram-positive, and anaerobic bacteria. Balofloxacin can be used for the research of respiratory, intestinal, and urinary tract infections.
  • HY-108908
    (Rac)-Modipafant

    UK-74505

    Others Infection Inflammation/Immunology
    (Rac)-Modipafant (UK-74505) is an orally active, selective, long-acting irreversible platelet activating factor receptor (PAFR) antagonist. (Rac)-Modipafant prevents dengue infection.
  • HY-13337
    BMS-986094

    INX-08189

    HCV Infection
    BMS-986094 (INX-08189) is a potent inhibitor of hepatitis C virus (HCV) replication, with an EC50 of 35 nM at 24 h in Huh-7 cells. BMS-986094 is a phosphoramidate prodrug of 6-O-methyl-2’-C-methyl guanosine. BMS-986094 can be used for the research of chronic HCV infection.
  • HY-128204
    AN3661

    Parasite Infection
    AN3661, a potent antimalarial lead compound, targets a Plasmodium falciparum cleavage and polyadenylation specificity factor homologue subunit 3 (PfCPSF3). AN3661 inhibits Plasmodium falciparum laboratory-adapted strains (mean IC50=32 nM), Ugandan field isolates (mean ex vivo IC50=64 nM), and murine P. berghei and P. falciparum infections.
  • HY-151376
    SAP2-IN-1

    Proteasome Infection
    SAP2-IN-1 is a secreted aspartic protease 2 (SAP2) inhibitor and has potent SAP2 inhibitory activity with an IC50 value of 0.92 μM. SAP2-IN-1 also is a virulence factor inhibitor and is inactive in vitro. SAP2-IN-1 can be used for the research of infection.
  • HY-19594
    Teclozan

    WIN 13146

    Parasite Infection
    Teclozan (WIN 13146) is an antiprotozoal agent, class in benzylamine derivatives. Teclozan intervenes in the phospholipid metabolism preventes the formation of arachidonic acid. Teclozan acts in the intestinal lumen being effective in Anti-G. intestinalis. Teclozan can be used for the research of protozoan infections.
  • HY-B0159A
    Balofloxacin dihydrate

    Q-35 dihydrate

    Bacterial Antibiotic Infection
    Balofloxacin dihydrate (Q-35 dihydrate) is an orally active fluoroquinolone antibiotic with broad-spectrum antibacterial activity against gram-negative, gram-positive, and anaerobic bacteria. Balofloxacin dihydrate can be used for the research of respiratory, intestinal, and urinary tract infections.
  • HY-147349
    ANT3310 sodium

    Bacterial Infection
    ANT3310 sodium is a broad-spectrum covalent Serine β-Lactamase inhibitor, with IC50 values ranging from 1 nM to 175 nM (a panel of Serine β-Lactamase). ANT3310 sodium potentiates activity of β-lactam antibiotics against Carbapenem-Resistant Enterobacterales (CRE) and Acinetobacter baumannii (CRAB). ANT3310 sodium can be used in the research of bacterial infection.
  • HY-143760
    Cap-dependent endonuclease-IN-11

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-11 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-11 has the potential for the research of viral infections (extracted from patent WO2021129602A1, compound DSC126).
  • HY-B1257
    Cefmetazole sodium

    Sodium cefmetazole

    Bacterial Antibiotic Infection
    Cefmetazole sodium (Sodium cefmetazole) is a semisynthetic cephamycin antibiotic with broad-spectrum antibacterial activity, covering gram-positive, gram-negative, and anaerobic bacteria. Cefmetazole sodium binds to penicillin binding proteins (PBPs), resulting in interfering bacterial cell wall biosynthesis. Cefmetazole sodium is used for the research of gynecologic, intraabdominal, urinary tract, respiratory tract and skin and soft tissue infections.
  • HY-W008216
    HMMNI

    Hydroxy Dimetridazole

    Drug Metabolite Others
    HMMNI (Hydroxy dimetridazole) is a hydroxy metabolite of Dimetridazole. Dimetridazole is a nitroimidazole class drug that combats protozoan infections.
  • HY-B1595
    Cefmetazole

    CS 1170

    Antibiotic Bacterial Infection
    Cefmetazole (CS 1170) is a semisynthetic cephamycin antibiotic with broad-spectrum antibacterial activity, covering gram-positive, gram-negative and anaerobic bacteria. Cefmetazole binds to penicillin binding proteins (PBPs), resulting in interfering bacterial cell wall biosynthesis. Cefmetazole is used for the research of gynecologic, intraabdominal, urinary tract, respiratory tract and skin and soft tissue infections.
  • HY-A0161A
    Chlophedianol hydrochloride

    Clofedanol hydrochloride; Calmotusin hydrochloride; NSC 113595 hydrochloride

    Others Infection
    Chlophedianol (Clofedanol) hydrochloride is an orally active and potent antitussive agent. Chlophedianol hydrochloride can be used for the research of acute cough due to upper respiratory tract infections (URIs).
  • HY-17452
    Cefditoren sodium

    ME 1206

    Bacterial Infection Inflammation/Immunology
    Cefditoren sodium (ME 1206) is a broad-spectrum, third-generation, oral cephalosporin antibacterial with enhanced stability against many common β lactamases. Cefditoren sodium has activity against Gram-negative organisms and Gram-positive organisms. Cefditoren sodium can be used in the research of infection diseases such as acute exacerbations of chronic bronchitis, community-acquired pneumonia (CAP), streptococcal pharyngitis/tonsillitis, or uncomplicated skin and skin structure infections.
  • HY-145265
    Antimicrobial photosensitizer-1

    Bacterial Infection
    Antimicrobial photosensitizer-1 is a promising candidate as the antimicrobial photosensitizer for combating pathogenic microorganism infections. Antimicrobial photosensitizer-1 exhibits an impressive antimicrobial efficacy in S. aureus-infected mice wounds.
  • HY-147217
    Bepirovirsen

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
  • HY-P2292
    Omiganan-FITC

    Bacterial Fungal Infection
    Omiganan-FITC is a peptide-FITC complex composed of Omiganan and a FITC. Omiganan is a bactericidal and fungicidal cationic peptide being developed as a topical gel for prevention of catheter-associated infections. FITC is a derivative of fluorescein for the labeling of amines.
  • HY-17452A
    Cefditoren (Pivoxil)

    Cefditoren pivoxyl; Cefditoren pivaloyloxymethyl ester; ME 1207

    Bacterial Antibiotic Infection Inflammation/Immunology
    Cefditoren Pivoxil (ME 1207) is a broad-spectrum, third-generation, oral cephalosporin antibacterial with enhanced stability against many common β lactamases. Cefditoren Pivoxil has activity against Gram-negative organisms and Gram-positive organisms. Cefditoren Pivoxil can be used in the research of infection diseases such as acute exacerbations of chronic bronchitis, community-acquired pneumonia (CAP), streptococcal pharyngitis/tonsillitis, or uncomplicated skin and skin structure infections.
  • HY-123601
    DHQZ 36

    Parasite Infection
    DHQZ 36 is a potent inhibitor of retrograde trafficking. DHQZ 36 inhibits Leishmania amazonensis infection in macrophages with an EC50 of 13.63 μM. DHQZ 36 has potent anti-parasite activity.
  • HY-50001
    Nucleozin

    Influenza Virus Infection
    Nucleozin, a potent inhibitor of influenza A virus infection, induces the formation of nucleoprotein (NP) aggregates and antagonizes its nuclear accumulation, leading to cessation of viral replication. Nucleozin impedes influenza A virus replication in vitro with a nanomolar EC50.
  • HY-B1156
    Cephradine

    Cefradine; SQ-11436

    Bacterial Antibiotic TOPK Infection Inflammation/Immunology
    Cephradine (Cefradine) is a broad-spectrum and orally active cephalosporin. Cephradine is active against both gram-positive and gram-negative pathogens. Cephradine is effective in eradicating most penicillinase-producing organisms. Cephradine has been used in the research of genitourinary, gastrointestinal and respiratory tract infections, and in infections of the skin and soft tissues. Cephradine blocks solar-ultraviolet induced skin inflammation through direct inhibition of TOPK.
  • HY-P99028
    Ibalizumab

    TMB-355; TNX-355

    HIV Infection
    Ibalizumab (TMB-355) is a humanised IgG4 monoclonal antibody that prevents HIV cell entry by binding to CD4 receptor. Ibalizumab has the potential for HIV-1 infection research.
  • HY-125789
    PF-04753299

    Bacterial Infection
    PF-04753299 is a potent and selective UDP-3-O-(R-3-hydroxymyristol)-N-acetylglucosamine deacetylase (LpxC) inhibitor. PF-04753299 is bactericidal for the gonococcal isolates. PF-04753299 inhibits E. coli, P. aeruginosa and K. pneumoniae strains with MIC90 values of 2 μg/ml, 4 μg/ml and 16 μg/ml, respectively. PF-04753299 is used for the study of gram-negative bacteria infection.
  • HY-B0322A
    Sulfamethoxazole sodium

    Ro 4-2130 sodium

    Bacterial Antibiotic Infection
    Sulfamethoxazole sodium (Ro 4-2130 sodium) is a sulfonamide bacteriostatic antibiotic. Sulfamethoxazole sodium is used to treat various urinary tract pathogens and in combination with Trimethoprim is considered the gold standard in the treatment of urinary tract infections (UTIs).
  • HY-A0294
    Ertapenem

    MK-0826

    Antibiotic Bacterial Infection
    Ertapenem (MK-0826) is a broad spectrum and long acting β-lactam antibiotic. Ertapenem has a broad-spectrum anti-anaerobic activity against a variety of anaerobes with a mode MIC of 0.12 μg/mL. Ertapenem can be used for the research of severe infections caused by bacteria in the skin, lungs, stomach, pelvis, and urinary tract.
  • HY-146079
    Antifungal agent 31

    Fungal Infection
    Antifungal agent 31 (compound 12) is a potent and orally active triazole antifungal agents with a pyrrolotriazinone scaffold. Antifungal agent 31 shows antifungal activity against Candida spp. and filamentous fungi. Antifungal agent 31 significantly reduced mortality rates and kidney fungal burden in two murine models of lethal systemic infections.
  • HY-B0322S1
    Sulfamethoxazole-13C6

    Antibiotic Bacterial Infection
    Sulfamethoxazole-13C6 is a 13C labeled Sulfamethoxazole. Sulfamethoxazole (Ro 4-2130) is a sulfonamide bacteriostatic antibiotic, used for bacterial infections. Sulfonamides is a competitive antagonist of para-aminobenzoic acid (PABA).
  • HY-128449
    Cephradine monohydrate

    Cefradine monohydrate

    Bacterial Antibiotic TOPK Infection Inflammation/Immunology
    Cephradine (Cefradine) monohydrate is a broad-spectrum and orally active cephalosporin. Cephradine monohydrate is active against both grampositive and gram-negative pathogens and effective in eradicating most penicillinase-producing organisms known to be resistant to penicillin G, penicillin V, and ampicillin. Cephradine monohydrate has been used in the research of genitourinary, gastrointestinal and respiratory tract infections, and in infections of the skin and soft tissues. Cephradine monohydrate blocks solar-ultraviolet induced skin inflammation through direct inhibition of TOPK.
  • HY-A0294A
    Ertapenem disodium

    MK-0826 disodium

    Bacterial Antibiotic Infection
    Ertapenem (MK-0826) disodium is a broad spectrum and long acting β-lactam antibiotic. Ertapenem disodium has a broad-spectrum anti-anaerobic activity against a variety of anaerobes with a mode MIC of 0.12 μg/mL. Ertapenem disodium can be used for the research of severe infections caused by bacteria in the skin, lungs, stomach, pelvis, and urinary tract.
  • HY-B1144A
    Chlormidazole hydrochloride

    Clomidazole hydrochloride

    Fungal Infection
    Chlormidazole hydrochloride is an antifungal agent and has inhibitory activity against many fungi and some gram-positive cocci. Chlormidazole hydrochloride can be applied in fungal and bacterial infections of nails and skin, including interdigital and periungual mycoses.
  • HY-128357
    Ibezapolstat

    ACX-362E; GLS-362E

    Bacterial DNA/RNA Synthesis Infection
    Ibezapolstat (ACX-362E) is a first-in-class, orally active DNA polymerase IIIC (pol IIIC) inhibitor, with a Ki of 0.325 μM for the DNA pol IIIC from C. difficile. Ibezapolstat is developed for the research of C. difficile infection(CDI).
  • HY-151380
    LANA-DNA-IN-1

    Others Infection
    LANA-DNA-IN-1 is a potent LANA-DNA inhibitor. LANA-DNA-IN-1 has inhibition activity for LBS2, LBS1 and LBS3 with IC50 values of 8 μM, 9μM and 8μM. LANA-DNA-IN-1shows against wild-type LANA with IC50 value of 53 μM. LANA-DNA-IN-1 can be used for the research of infection.
  • HY-151164
    LasR-IN-2

    Bacterial Infection
    LasR-IN-2 is a LasR inhibitor that forms H-bonding with TRY-56 residue. LasR-IN-2 can be used in the research of bacterial infection, neutropenia, severe burns and chronic lung disease in cystic fibrosis (CF).
  • HY-P9803
    Anti-SARS-80R mAb

    SARS-80R; SARS Antibody-80R

    SARS-CoV Infection
    Anti-SARS-80R mAb (SARS-80R) is a human monoclonal IgG1 antibody produced in CHO cells. Anti-SARS-80R mAb can specifically bind to Spike (S1) protein to prevent SARS virus infection of susceptible cells.
  • HY-N8168
    LPRP-Et-97543

    HBV Infection
    LPRP-Et-97543 is a potent anti-HBV agent. LPRP-Et-97543 reduces Core, S, and preS but not X promoter activities. LPRP-Et-97543 can be used for acute and chronic HBV infections research.
  • HY-B0510
    Trimethoprim

    Antifolate Bacterial Antibiotic Influenza Virus Infection
    Trimethoprim is a bacteriostatic antibiotic and an orally active dihydrofolate reductase inhibitor. Trimethoprim is active against a wide range of Gram-positive and Gram-negative aerobic bacteria. Trimethoprim has the potential for the research of urinary tract infections, Shigellosis and Pneumocystis pneumonia. Trimethoprim can inhibit infection of Influenza A virus in chick embryo when combinated with zinc.
  • HY-B0510B
    Trimethoprim hydrochloride

    Antifolate Bacterial Antibiotic Influenza Virus Infection
    Trimethoprim hydrochloride is a bacteriostatic antibiotic and an orally active dihydrofolate reductase inhibitor. Trimethoprim hydrochloride is active against a wide range of Gram-positive and Gram-negative aerobic bacteria. Trimethoprim hydrochloride has the potential for the research of urinary tract infections, Shigellosis and Pneumocystis pneumonia. Trimethoprim hydrochloride can inhibit infection of Influenza A virus in chick embryo when combinated with zinc.
  • HY-B1597
    Cetalkonium chloride

    Benzyldimethylhexadecylammonium chloride

    Bacterial Infection Inflammation/Immunology
    Cetalkonium chloride is an ammonium antiseptic agent used in many topical drugs for infections of mouth, throat and eye. Cetalkonium chloride acts as anti-inflammatory amphiphilic agent.
  • HY-14283
    Luliconazole

    NND 502

    Fungal Antibiotic Infection
    Luliconazole (NND 502) is a topical antifungal imidazole antibiotic with broad-spectrum and potent antifungal activity. Luliconazole can be used for the research of skin infection, including dermatophytosis, tinea corporis, tinea pedis et al.
  • HY-144833
    SARS-CoV-2 3CLpro-IN-1

    SARS-CoV Infection
    SARS-CoV-2 3CLpro-IN-1 (Compound 14c) is a potent inhibitor of SARS-CoV-2 3CL pro. 3CL pro (main coronaviruses cysteine-protease) has been identified as a promising target for the development of antiviral drugs. SARS-CoV-2 3CLpro-IN-1 has the potential for the research of infection diseases.
  • HY-119972
    Diloxanide

    Parasite Infection
    Diloxanide is an anti-protozoal agent and can be used for the research of asymptomatic-intestinal amebiasis caused by Entamoeba histolytica or some other protozoal infections. Diloxanide is an active luminal amebicide and hydrolyzed in the gastrointestinal tract from its prodrug Diloxanide furoate (HY-B1147).
  • HY-143766
    Cap-dependent endonuclease-IN-13

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-13 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-13 has the potential for the research of influenza virus infection (only influenza A) (extracted from patent WO2021180147A1, compound I-1).
  • HY-14865B
    Omadacycline tosylate

    PTK 0796 tosylate; Amadacycline tosylate

    Bacterial Antibiotic Infection
    Omadacycline (PTK 0796) tosylate, a first-in-class orally active aminomethylcycline antibacterial, is a member of the tetracycline class of antibiotics. Omadacycline tosylate acts through the inhibition of bacterial protein synthesis by binding to the 30S ribosomal subunit. Omadacycline tosylate possesses broad-spectrum antibacterial activity against aerobic and anaerobic Gram-positive and Gram-negative bacteria, as well as atypical bacteria. Omadacycline tosylate can be used for the research of acute bacterial skin and skin-structure infections, community-acquired pneumonia, and urinary tract infections.
  • HY-14865C
    Omadacycline hydrochloride

    PTK0796 hydrochloride; Amadacycline hydrochloride

    Bacterial Antibiotic Infection
    Omadacycline (PTK 0796) hydrochloride, a first-in-class orally active aminomethylcycline antibacterial, is a member of the tetracycline class of antibiotics. Omadacycline hydrochloride acts through the inhibition of bacterial protein synthesis by binding to the 30S ribosomal subunit. Omadacycline hydrochloride possesses broad-spectrum antibacterial activity against aerobic and anaerobic Gram-positive and Gram-negative bacteria, as well as atypical bacteria. Omadacycline hydrochloride can be used for the research of acute bacterial skin and skin-structure infections, community-acquired pneumonia, and urinary tract infections.
  • HY-14865
    Omadacycline

    PTK 0796; Amadacycline

    Bacterial Antibiotic Infection
    Omadacycline (PTK 0796), a first-in-class orally active aminomethylcycline antibacterial, is a member of the tetracycline class of antibiotics. Omadacycline acts through the inhibition of bacterial protein synthesis by binding to the 30S ribosomal subunit. Omadacycline possesses broad-spectrum antibacterial activity against aerobic and anaerobic Gram-positive and Gram-negative bacteria, as well as atypical bacteria. Omadacycline can be used for the research of acute bacterial skin and skin-structure infections, community-acquired pneumonia, and urinary tract infections.
  • HY-14865A
    Omadacycline mesylate

    PTK 0796 mesylate; Amadacycline mesylate

    Bacterial Antibiotic Infection
    Omadacycline (PTK 0796) mesylate, a first-in-class orally active aminomethylcycline antibacterial, is a member of the tetracycline class of antibiotics. Omadacycline mesylate acts through the inhibition of bacterial protein synthesis by binding to the 30S ribosomal subunit. Omadacycline mesylate possesses broad-spectrum antibacterial activity against aerobic and anaerobic Gram-positive and Gram-negative bacteria, as well as atypical bacteria. Omadacycline mesylate can be used for the research of acute bacterial skin and skin-structure infections, community-acquired pneumonia, and urinary tract infections.
  • HY-17532
    Haloxon

    Parasite Infection
    Haloxon is an anti-parasitic agent. Haloxon can be used for the research of infections of Parascaris equorum, Oxyuris equi and Strongylus vulgaris. Haloxon also can be used in control of ascarids and hookworms in domesticated animals in combination with Bidimazium.
  • HY-P3350
    LS-BF1

    Bacterial Infection
    LS-BF1 is a stable and low toxic cationic antimicrobial peptide. LS-BF1 displays broad spectrum of antibacterial activity, including the challenging ESKAPE pathogens, by cell membrane disruptive mechanism. LS-BF1 shows good in vivo efficacy for elimination of bacteria in a mouse infection model[1].
  • HY-121544A
    Methicillin sodium hydrate

    Bacterial Antibiotic Histamine Receptor Infection
    Methicillin sodium hydrate is a narrow-spectrum β-lactam antibiotic, acts by inhibiting penicillin-binding proteins (PBPs). Methicillin sodium hydrate is active against Staphylococcus aureus and Staphylococcus epidermidis that are resistant to other penicillins. Methicillin sodium hydrate can be used for the research of skin infections, osteomyelitis, and endocarditis.
  • HY-121544
    Methicillin

    Bacterial Infection
    Methicillin is a narrow-spectrum β-lactam antibiotic, acts by inhibiting penicillin-binding proteins (PBPs). Methicillin is active against Staphylococcus aureus and Staphylococcus epidermidis that are resistant to other penicillins.Methicillin can be used for the research of skin infections, osteomyelitis, and endocarditis.
  • HY-W011522
    Taurolidine

    Bacterial Apoptosis Antibiotic Cancer Infection
    Taurolidine is a broad-spectrum antimicrobial for the prevention of central venous catheter-related infections. Taurolidine has a direct and selective antineoplastic effect on brain tumor cells by the induction of apoptosis.
  • HY-114518
    Butenafine

    KP363

    Fungal Infection
    Butenafine (KP363) is a potent and broad spectrum benzylamine antifungal agent. Butenafine inhibits fungal ergosterol biosynthesis at the point of squalene epoxidation, leading to a deficiency of the fungal cell membranes. Butenafine is effective against dermatophytes infections, such as  tinea pedis,  tinea cruris, tinea versicolor.
  • HY-131905S
    BMS-986144

    HCV Protease HCV Cancer Infection Inflammation/Immunology
    BMS-986144 is a third-generation, pan-genotype (GT) NS3/4A protease inhibitor. BMS-986144 inhibits HCV replicon with EC50s of 2.3, 0.7, 1.0, 12, 8.0, and 5.8 nM for GT-1a, GT-1b, GT-2a, GT-3a, 1a R155X, and 1b D168V, respectively. BMS-986144 has the potential for the research of HCV infection.
  • HY-Y1718
    Tridecanoic acid

    N-Tridecanoic acid

    Endogenous Metabolite Bacterial Infection Metabolic Disease
    Tridecanoic acid (N-Tridecanoic acid), a 13-carbon medium-chain saturated fatty acid, can serve as an antipersister and antibiofilm agent that may be applied to research bacterial infections. Tridecanoic acid inhibits Escherichia coli persistence and biofilm formation.
  • HY-147321
    3'-DMTr-dG(iBu)

    Tau Protein HBV Infection Neurological Disease
    3'-DMTr-dG(iBu) is a nucleoside for the synthesis of nucleic acid, such as antiviral agents used in the research of viral infection (HBV, HDV), and oligonucleotides against Alzheimer’s disease and other tauopathies.
  • HY-N10495
    Seconeolitsine

    Antibiotic Bacterial Topoisomerase Infection
    Seconeolitsine, an antibiotic, and is an inhibitor of targeting topoisomerase I (TopA). Seconeolitsine also is a new antimicrobial agent that can inhibit S. pneumoniae growth. Seconeolitsine can inhibit TopA relaxation activity with an IC50 value of 17 μM. Seconeolitsine can be used for the research of S. pneumoniae infections resistant to other antibiotics.
  • HY-13625
    Ertapenem sodium

    L-749345; MK-826

    Bacterial Antibiotic Infection Cancer
    Ertapenem sodium (L-749345) is a broad spectrum and long acting β-lactam antibiotic. Ertapenem sodium has a broad-spectrum anti-anaerobic activity against a variety of anaerobes with a mode MIC of 0.12 μg/mL. Ertapenem sodium can be used for the research of severe infections caused by bacteria in the skin, lungs, stomach, pelvis, and urinary tract.
  • HY-B1002
    Oxolinic acid

    Bacterial Antibiotic DNA/RNA Synthesis Infection
    Oxolinic acid is an antibiotic against both Gram-negative and Gram-positive bacteria. Oxolinic acid can be used for the research of acute and chronic urinary tract infections. Oxolinic acid is a DNA/RNA synthesis inhibitor. Oxolinic acid acts a dopamine uptake inhibitor and stimulants locomotor effect in mice.
  • HY-14913
    Apricitabine

    SPD754; AVX754

    Nucleoside Antimetabolite/Analog HIV DNA/RNA Synthesis Infection
    Apricitabine (SPD754; AVX754), the (-) enantiomer of 2′-deoxy-3′-oxa-4′-thiocytidine (dOTC), is a highly selective and orally active HIV-1 reverse transcriptase (RT) inhibitor (Ki=0.08 μM), as well as inhibits DNA polymerases α, β, and γ with Ki value of 300 μM, 12 μM, and 112.25 μM, respectively. Apricitabine (SPD754; AVX754) shows promising antiretroviral efficacy, good tolerability and a low propensity for resistance selection in antiretroviral-naive HIV infection[2].
  • HY-144062
    INSCoV-614(1B)

    SARS-CoV Infection
    INSCoV-614(1B) is a potent inhibitor of M pro (3CL pro). Proteases (PL pro and 3CL pro) are involved with transcription and replication of the virus. INSCoV-614(1B) has the potential for the research of SARS-CoV-2 infection (extracted from patent WO2021219089A1).
  • HY-104077
    Remdesivir

    GS-5734

    DNA/RNA Synthesis SARS-CoV Infection
    Remdesivir (GS-5734), a nucleoside analogue with effective antiviral activity, has EC50s of 3.3 μM, 4.7 μM, 32 μM, 3.7 μM and 9.2 μM for SARS-CoV-2 and its variants alpha, beta, gamma and delta, respectively. Remdesivir is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro.
  • HY-15287
    Nelfinavir

    AG1341

    HIV Protease HIV Infection Cancer
    Nelfinavir (AG-1341) is a potent and orally bioavailable HIV-1 protease inhibitor (Ki=2 nM) for HIV infection. Nelfinavir is a broad-spectrum, anticancer agent.
  • HY-128382
    Brilliant Black BN

    E 151

    Enterovirus Infection
    Brilliant black BN (E151) is an azo dye and a food colorant. Brilliant black BN is a promising antiviral agent against EV71 infection via inhibiting the interaction between EV71 and its cellular uncoating factor cyclophilin A. Brilliant black BN has the potential for the investigation of contagious disease.
  • HY-143769
    Cap-dependent endonuclease-IN-15

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-15 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-15 inhibits the replication of influenza virus. Cap-dependent endonuclease-IN-15 has the potential for the research of viral infections caused by influenza viruses (extracted from patent CN113226327A, compound c-1).
  • HY-144063
    INSCoV-600K(1)

    SARS-CoV Infection
    INSCoV-600K(1) is a potent inhibitor of M pro (3CL pro). Proteases (PL pro and 3CL pro) are involved with transcription and replication of the virus. INSCoV-600K(1) has the potential for the research of SARS-CoV-2 infection (extracted from patent WO2021219089A1).
  • HY-144061
    INSCoV-601I(1)

    SARS-CoV Infection
    INSCoV-601I(1) is a potent inhibitor of M pro (3CL pro). Proteases (PL pro and 3CL pro) are involved with transcription and replication of the virus. INSCoV-601I(1) has the potential for the research of SARS-CoV-2 infection (extracted from patent WO2021219089A1).
  • HY-B1085
    Cinoxacin

    Compound 64716

    Bacterial Antibiotic DNA/RNA Synthesis Infection
    Cinoxacin (Compound 64716), a synthetic antimicrobial related to the quinolone class of orally active antibacterial agent. Cinoxacin has antibacterial activity against many gram-negative aerobic bacteria and inhibits bacterial DNA synthesis. Cinoxacin can be used for the research of urinary tract infections and bacterial prostatitis.
  • HY-15287A
    Nelfinavir Mesylate

    AG 1343 Mesylate

    HIV Protease HIV Cancer Infection
    Nelfinavir Mesylate (AG 1343 Mesylate) is a potent and orally bioavailable HIV-1 protease inhibitor (Ki=2 nM) for HIV infection. Nelfinavir Mesylate (AG 1343 Mesylate) is a broad-spectrum, anticancer agent.
  • HY-104077S
    Remdesivir-d5

    GS-5734-d5

    DNA/RNA Synthesis SARS-CoV Infection
    Remdesivir-D5 (GS-5734-D5) is a deuterium labeled Remdesivir. Remdesivir (GS-5734) is a nucleoside analogue, with effective antiviral activity, with EC50s of 74 nM for SARS-CoV and MERS-CoV in HAE cells, and 30 nM for murine hepatitis virus in delayed brain tumor cells. Remdesivir is highly effective in the control of 2019-nCoV (COVID-19) infection in vitro.
  • HY-146379
    SARS-CoV-2-IN-19

    SARS-CoV Infection
    SARS-CoV-2-IN-19 (Compound 6g) is a potent inhibitor of SARS-CoV-2 with an EC50 of 8.8 μM. SARS-CoV-2-IN-19 shows potent activity against SARS-CoV-2 helicase (nsp13), a highly conserved enzyme, highlighting a potentiality against emerging HCoVs outbreaks. SARS-CoV-2-IN-19 has the potential for the research of infection diseases.
  • HY-N8188
    Dehydrojuncusol

    HCV HCV Protease Infection
    Dehydrojuncusol, a potent HCV inhibitor, targets HCV NS5A and is able to inhibit RNA replication of replicons harboring resistance mutations to anti-NS5A direct-acting antivirals. Dehydrojuncusol significantly inhibits HCV infection when added after virus inoculation of HCV genotype 2a (EC50=1.35 µM).
  • HY-143768
    Cap-dependent endonuclease-IN-14

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-14 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-14 inhibits the replication of influenza virus. Cap-dependent endonuclease-IN-14 has the potential for the research of viral infections caused by influenza viruses (extracted from patent CN113620948A, compound 1-c).
  • HY-151445
    ZIKV-IN-2

    DNA Methyltransferase Virus Protease Infection
    ZIKV-IN-2 (compound 3a) is a potent ZIKV NS5 methyl transferase (MTase) inhibitor with an IC50 value of 38.86 μM. ZIKV-IN-2 inhibits ZIKV replication and infection. ZIKV-IN-2 can be used in research of Zika virus (ZIKV).
  • HY-14737A
    Ceftaroline fosamil (hydrate)(acetate)

    TAK-599 (hydrate)(acetate); PPI0903 (hydrate)(acetate)

    Antibiotic Bacterial Infection
    Ceftaroline fosamil hydrate acetate is a potent cephalosporin antibiotic. Ceftaroline fosamil hydrate acetate shows broad-spectrum activity against Gram-positive pathogens, including methicillin-resistant Staphylococcus aureus (MRSA) and multidrug-resistant Streptococcus pneumoniae, and common Gram-negative organisms. Ceftaroline fosamil hydrate acetate has anti-infective activity, and can be used for the research of complicated skin and skin structure infections (cSSSIs) and community-acquired bacterial pneumonia (CABP).
  • HY-126419
    Kobophenol A

    SARS-CoV PKC Infection
    Kobophenol A, an oligomeric stilbene, blocks the interaction between the ACE2 receptor and S1-RBD with an IC50 of 1.81 μM and inhibits SARS-CoV-2 viral infection in cells with an EC50 of 71.6 μM. Kobophenol A inhibits the activity of partially purified rat brain protein kinase C (PKC) with an IC50 of 52 µM.
  • HY-14532
    Brincidofovir

    CMX001; HDP-CDV

    CMV HSV Orthopoxvirus Infection
    Brincidofovir (CMX001), the lipid-conjugated prodrug of Cidofovir (HY-17438), is an orally available, long-acting antiviral. Brincidofovir shows activity against a broad spectrum of DNA viruses including cytomegalovirus (CMV), adenovirus (ADV), varicella zoster virus, herpes simplex virus, polyomaviruses, papillomaviruses, poxviruses, and mixed double-stranded DNA virus infections. Brincidofovir, an oral antiviral in late stage development, has proven effective against orthopoxviruses in vitro and in vivo..
  • HY-N7696
    Physalin F

    Apoptosis Inflammation/Immunology
    Physalin F is a secosteroid with potent anti-inflammatory and immunomodulatory activities. Physalin F induces apoptosis of PBMC, decreasing the spontaneous proliferation and cytokine production caused by Human T-lymphotropic virus type 1 (HTLV-1) infection.
  • HY-19840
    Voxilaprevir

    GS-9857

    HCV Protease Infection
    Voxilaprevir (GS-9857) is a noncovalent, reversible inhibitor of HCV NS3/4A protease inhibitor (PI) with pangenotypic antiviral activity. Voxilaprevir inhibits genotype 1b and 3a wild-type NS3 proteases with Ki values of 0.038 nM and 0.066 nM, respectively. Voxilaprevir is an orally active direct-acting antiviral agent (DAA) and can be used for HCV infection research.
  • HY-A0248A
    Polymyxin B1

    Bacterial Infection
    Polymyxin B1 is a potent antimicrobial lipopeptide first derived from Bacilus polymyxa. Polymyxin B1 is the major component in Polymyxin B (HY-A0248). Polymyxin B1 can induce lysis of bacterial cells through interaction with their membranes. Polymyxin B1 has the potential for multidrug-resistant Gram-negative bacterial infections treatment.
  • HY-B1916
    Acetylspiramycin

    Spiramycin B; Spiramycin II; Foromacidin B

    Antibiotic Bacterial Infection
    Acetylspiramycin (Spiramycin B; Spiramycin II; Foromacidin B) is a potent and orally active macrolide antibiotic produced by various Streptomyces species, an acetylated derivative of Spiramycin (HY-100593). Acetylspiramycin is an antimicrobial agent with activity against gram-positive organisms, including Streptococcus pyogenes, S. viridans, Corynebacterium diphtheriae and methicillin-sensitive Staphylococcus aureus. Acetylspiramycin is also a potent antiprotozoal agent that against parasitic infection caused by Cryptosporidium spp.
  • HY-145741
    MptpB-IN-1

    Antibiotic Infection
    MptpB-IN-1 (Compound 13) is a potent and orally active inhibitor of MptpB. Mycobacterium tuberculosis protein-tyrosine-phosphatase B (MptpB) is a secreted virulence factor that subverts antimicrobial activity in the host. MptpB-IN-1 reduces multidrug-resistant mycobacterium tuberculosis survival and infection burden.
  • HY-B0455B
    Lomefloxacin (aspartate)

    SC47111A (aspartate)

    Bacterial Antibiotic Infection
    Lomefloxacin (SC47111A) aspartate is a broad-spectrum quinolone antibiotic, with antimicrobial activity. Lomefloxacin aspartate can be used for researching respiratory tract infections, genitourinary infections, gastrointestinal infections, ENT infections, etc..
  • HY-144347
    HF51116

    CXCR Cancer Infection
    HF51116 is a potent antagonist of CXCR4. HF51116 strongly antagonizes SDF-1α-induced cell migration, calcium mobilization, and CXCR4 internalization. HF51116 inhibits HIV-1 infection via CXCR4. HF51116 has the potential for the research of HIV-1 infection, hematopoietic stem cell mobilization, and cancer metastasis.
  • HY-144068
    Cap-dependent endonuclease-IN-25

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-25 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-25 is a macrocyclic pyridotriazine derivative. Cap-dependent endonuclease-IN-25 has the potential for the research of viral infections caused by viruses belonging to the Orthomyxoviridae family (extracted from patent WO2020075080A1, compound 4).
  • HY-130379
    Propargyl-PEG8-acid

    ADC Linkers PROTAC Linkers Bacterial Cancer Infection
    Propargyl-PEG8-acid is a PEG-based PROTAC linker can be used in the synthesis of PROTACs. Propargyl-PEG8-acid is a cleavable ADC linker used in the synthesis of antibody-drug conjugates (ADCs). The ADCs can be used in bacterial infections caused by Gram-negative bacteria.
  • HY-123305
    5-Hydroxymebendazole

    Others Others
    5-Hydroxymebendazole is the one metabolite of Benzimidazoles. Benzimidazoles are safe, broad-spectrum anthelmintic drugs and are widely used for prevention and treatment of parasitic infections in food-producing animals.
  • HY-A0208
    Rosoxacin

    Acrosoxacin

    Bacterial Antibiotic Infection
    Rosoxacin (Acrosoxacin) is an orally active and broad-spectrum antibacterial quinolone antibiotic. Rosoxacin inhibits Gram-negative bacteria, including N. gonorrhoeae (MIC range=0.03-0.125 µg/mL).Rosoxacin can be used in studies of urinary tract infections and certain sexually transmitted diseases.
  • HY-151446
    ZIKV-IN-3

    DNA Methyltransferase Virus Protease Infection
    ZIKV-IN-3 (compound 5a), an andrographolide derivatives, is a potent ZIKV NS5 methyl transferase (MTase) inhibitor with an IC50 value of 18.34 μM. ZIKV-IN-3 inhibits ZIKV replication and infection. ZIKV-IN-3 can be used in research of Zika virus (ZIKV).
  • HY-144047
    HBV-IN-16

    HBV DNA/RNA Synthesis Infection
    HBV-IN-16 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-16 is a quinoline derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2019121357A1, compound 1).
  • HY-144046
    HBV-IN-15

    HBV DNA/RNA Synthesis Infection
    HBV-IN-15 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-15 is a flavone derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2020052774A1, compound 2).
  • HY-144045
    HBV-IN-14

    HBV DNA/RNA Synthesis Infection
    HBV-IN-14 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-14 is a pyridinopyrimidinones compound. HBV-IN-14 has the potential for the research of HBV infection (extracted from patent WO2021190502A1, compound 5).
  • HY-B0509
    Amikacin hydrate

    BAY 41-6551 hydrate

    Bacterial Antibiotic Infection
    Amikacin hydrate (BAY 41-6551 hydrate) is an aminoglycoside antibiotic and a semisynthetic analog of kanamycin. Amikacin hydrate is bactericidal, acting directly on the 30S and 50S bacerial ribosomal subunits to inhibit protein synthesis. Amikacin hydrate is very active against most Gram-negative bacteria including gentamicin- and tobramycin-resistant strains. Amikacin hydrate also inhibits the infections caused by susceptible Nocardia and nontuberculous mycobacteria.
  • HY-N7139A
    Penicillin G benzathine

    Benzathine benzylpenicillin

    Bacterial Antibiotic Infection
    Penicillin G benzathine (Benzathine benzylpenicillin) is an antibiotic against many bacterial infections.
  • HY-N0440
    Germacrone

    Influenza Virus Infection
    Germacrone is extracted from Rhizoma Curcuma. Germacrone inhibits influenza virus infection.
  • HY-121368
    Mahanine

    Parasite Cancer Infection Inflammation/Immunology
    Mahanine is a carbazole alkaloid with various biological properties. Mahanine is a potent anticancer agent against different types of cancer cells. Mahanine exhibits antileishmanial activity and can be used for Leishmania infection treatment research.
  • HY-B0337S
    Sulfadimethoxine-d4

    Sulphadimethoxine-d4

    Bacterial Infection
    Sulfadimethoxine D4 is a deuterium labeled Sulfadimethoxine (Sulphadimethoxine). Sulfadimethoxine is a sulfonamide antibiotic used to treat many infections including treatment of respiratory, urinary tract, enteric, and soft tissue infections.
  • HY-B0576
    Sulfacetamide Sodium

    Bacterial Antibiotic Infection
    Sulfacetamide Sodium is an anti-infective agent that is used topically to treat skin infections and orally for urinary tract infections.
  • HY-105752
    Loflucarban

    Fluonilid

    Fungal Infection
    Loflucarban (Fluonilid) is a potent antimycotic agent. Loflucarban can be used for the research of the ear infections.
  • HY-N7123
    Sulfacetamide

    Sulphacetamide

    Bacterial Antibiotic Infection
    Sulfacetamide (Sulphacetamide), a bacteriostatic sulphonamide, is a popular antibiotic prescribed for treating ocular infections.
  • HY-B0509B
    Amikacin disulfate

    BAY 41-6551 disulfate

    Bacterial Antibiotic Infection
    Amikacin disulfate (BAY 41-6551 dissulfate) is an aminoglycoside antibiotic and a semisynthetic analog of kanamycin. Amikacin disulfate is bactericidal, acting directly on the 30S and 50S bacerial ribosomal subunits to inhibit protein synthesis. Amikacin disulfate is very active against most Gram-negative bacteria including gentamicin- and tobramycin-resistant strains. Amikacin disulfate also inhibits the infections caused by susceptible Nocardia and nontuberculous mycobacteria.
  • HY-107813
    Amikacin sulfate

    BAY 41-6551 sulfate

    Bacterial Antibiotic Infection
    Amikacin sulfate (BAY 41-6551 sulfate) is an aminoglycoside antibiotic and a semisynthetic analog of kanamycin. Amikacin sulfate is bactericidal, acting directly on the 30S and 50S bacerial ribosomal subunits to inhibit protein synthesis. Amikacin sulfate is very active against most Gram-negative bacteria including gentamicin- and tobramycin-resistant strains. Amikacin sulfate also inhibits the infections caused by susceptible Nocardia and nontuberculous mycobacteria.
  • HY-B1782
    Sulfamoxole

    Bacterial Infection
    Sulfamoxole is a broad- spectrum chemotherapeutic antimicrobial agent. Sulfamoxole can be used for the study of pediatric infections.
  • HY-N7139B
    Penicillin G benzathine tetrahydrate

    Benzathine benzylpenicillin tetrahydrate

    Bacterial Infection
    Penicillin G benzathine tetrahydrate (Benzathine benzylpenicillin tetrahydrate) is an antibiotic against many bacterial infections.
  • HY-113678
    Colistin

    Polymyxin E

    Antibiotic Bacterial Infection
    Colistin (Polymyxin E) is an orally active polypeptide antibiotic. Colistin has excellent activity against various Gram-negative rod-shaped bacteria, including multidrug-resistant Pseudomonas aeruginosa, Acinetobacter baumannii and Klebsiella pneumoniae. Colistin is associated with nephrotoxicity. Colistin can be used for the research of infections caused by Gram-negative bacilli.
  • HY-B0330D
    (R)-Ofloxacin

    Dextrofloxacin

    Bacterial Infection
    (R)-Ofloxacin (Dextrofloxacin) is an antibiotic useful for the treatment of a number of bacterial infections. Antibacterial activity.
  • HY-132269
    Isoflupredone

    Others Inflammation/Immunology
    Isoflupredone belongs to the class of corticosteroids and exerts its effect by binding to glucocorticoid and mineralocorticoid receptors of animals, such as horses. Isoflupredone can be used in wide range of conditions, such as infection and inflammatory diseases.
  • HY-147876
    Antimicrobial agent-3

    Bacterial Fungal Infection
    Antimicrobial agent-3 (Compound U10) is an antimicrobial agent against bacterial, fungal and tubercular infections.
  • HY-B0555A
    Nafcillin sodium monohydrate

    Bacterial Antibiotic Infection
    Nafcillin sodium monohydrate, an antibiotic, is a reversible inhibitor of β-lactamase. Nafcillin sodium monohydrate can be used for the research of staphylococcal infections.
  • HY-B0239S
    Chloramphenicol-d5

    Bacterial Antibiotic Infection
    Chloramphenicol D5 is the deuterium labeled Chloramphenicol. Chloramphenicol is a broad-spectrum antibiotic against bacterial infections.
  • HY-139805
    Ticarcillin

    Antibiotic Bacterial Infection
    Ticarcillin is a semisynthetic, extended-spectrum, carboxypenicillin antibacterial agent, and is active against gram-positive cocci, including streptococci and staphylococci. Ticarcillin is also effective against most gram-negative organisms, including Pseudomonas aeruginosa. Ticarcillin can be used in lower respiratory tract infections, skin and skin structure infections, urinary tract infections, and intraabdominal infections research.
  • HY-B0549A
    Flavoxate hydrochloride

    Rec-7-0040; DW61

    Phosphodiesterase (PDE) Calcium Channel mAChR Neurological Disease
    Flavoxate hydrochloride is a potent and competitive phosphodiesterase (PDE) inhibitor. Flavoxate hydrochloride is an antispasmodic agent and muscarinic mAChR antagonist. Flavoxate hydrochloride shows moderate calcium antagonistic activity and local anesthetic effect. Flavoxate hydrochloride can be used for the research of overactive bladder (OAB) and lower urinary tract infections.
  • HY-B1244
    Dimetridazole

    1,2-Dimethyl-5-nitroimidazole

    Parasite Antibiotic Infection
    Dmetridazole (1,2-Dimethyl-5-nitroimidazole), a nitroimidazole-based antibiotic, combats protozoan infections.
  • HY-N4181
    Kanzonol C

    Bacterial Fungal Infection
    Kanzonol C, a flavonoid isolated from the twigs of Dorstenia barteri (Moraceae), has potential to treat bacterial and fungal infections.
  • HY-B0549
    Flavoxate

    Rec-7-0040 free base; DW61 free base

    Phosphodiesterase (PDE) Calcium Channel mAChR Neurological Disease
    Flavoxate is a potent and competitive phosphodiesterase (PDE) inhibitor. Flavoxate is an antispasmodic agent and muscarinic mAChR antagonist. Flavoxate shows moderate calcium antagonistic activity and local anesthetic effect. Flavoxate can be used for the research of overactive bladder (OAB) and lower urinary tract infections.
  • HY-N3754
    Dihydropinosylvin monomethyl ether

    Parasite Infection
    Dihydropinosylvin monomethyl ether is a natrual compound with nematicidal activity. Dihydropinosylvin monomethyl ether can inhibit pine wood nematodes infection.
  • HY-143478
    HIV-IN-1

    HIV Infection
    HIV-IN-1 (Compound 50) is a potent inhibitor of HIV. HIV-IN-2 has the potential for the research of HIV infection.
  • HY-143479
    HIV-IN-2

    HIV Infection
    HIV-IN-2 (Compound 100) is a potent inhibitor of HIV. HIV-IN-2 has the potential for the research of HIV infection.
  • HY-17431
    Fosamprenavir Calcium Salt

    GW433908G

    HIV Infection
    Fosamprenavir Calcium Salt (GW433908G) is a phosphate ester prodrug of the antiretroviral protease inhibitor Amprenavir, with improved solubility. Anti-HIV infection.
  • HY-B1784
    Sulfisomidin

    Sulfaisodimidine

    Bacterial Antibiotic Infection
    Sulfisomidin (Sulfaisodimidine) is an orally active short-acting sulfonamide antibacterial. Sulfisomidin can be used for the research of lower urinary tract infections.
  • HY-N2216
    Polygalasaponin XXXI

    Onjisaponin F

    Influenza Virus Infection
    Polygalasaponin XXXI (Onjisaponin F) is an effective adjuvant for intranasal administration of influenza Influenza hemagglutinin (HA) vaccine to protect influenza virus infection.
  • HY-78726
    Fosamprenavir

    Amprenavir phosphate; GW 433908

    HIV Infection
    Fosamprenavir (Amprenavir phosphate;GW 433908) is a phosphate ester prodrug of the antiretroviral protease inhibitor Amprenavir, with improved solubility. Anti-HIV infection.
  • HY-16487
    Temafloxacin

    TMFX; TA-167 free acid; A-62254 free acid

    Bacterial Antibiotic Infection
    Temafloxacin (TMFX) is an orally active quinolone broad-spectrum antibacterial agent. Temafloxacin is well tolerated in lower respiratory and genitourinary tract infections.
  • HY-113595
    Temafloxacin hydrochloride

    TMFX hydrochloride; TA-167; A-62254

    Antibiotic Bacterial Infection
    Temafloxacin (TMFX) hydrochloride is an orally active quinolone broad-spectrum antibacterial agent. Temafloxacin hydrochloride is well tolerated in lower respiratory and genitourinary tract infections.
  • HY-B1043
    Piromidic acid

    Bacterial Antibiotic Infection
    Piromidic acid is an antibacterial agent. Piromidic acid is active against gramnegative bacteria and staphylococci and can be used for the research of intestinal, urinary, and biliary tract infections.
  • HY-143757
    Cap-dependent endonuclease-IN-10

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-10 is a potent inhibitor of cap-dependent endonuclease (CEN). Not only can Cap-dependent endonuclease-IN-10 inhibit influenza virus well, but also has lower cytotoxicity, better in vivo pharmacokinetic and in vivo pharmacodynamic properties, and better hepatic microsomal stability. Cap-dependent endonuclease-IN-10 has the potential for the research of viral infections (including influenza A, influenza B and influenza C) (extracted from patent WO2021129799A1, compound 1-1).
  • HY-136462
    CYM50358

    LPL Receptor Infection
    CYM50358 is a potent and selective S1PR4 antagonist, with an IC50 of 25 nM. CYM50358 can be used for the research of influenza infection.
  • HY-100577
    Ticarcillin sodium

    Bacterial Antibiotic Infection
    Ticarcillin sodium is an injectable antibiotic for the treatment of Gram-negative bacteria, particularly Pseudomonas aeruginosa. It is also one of the few antibiotics capable of treating Stenotrophomonas maltophilia infections.
  • HY-N4118
    Cephaeline

    (-)-Cephaeline; NSC 32944 free base

    Influenza Virus Filovirus Infection
    Cephaeline is a phenolic alkaloid in Indian Ipecac roots. Cephaeline exhibits potent inhibition of both Zika virus (ZIKV) and Ebola virus (EBOV) infections.
  • HY-B0555
    Nafcillin

    Antibiotic Bacterial Infection
    Nafcillin, an antibiotic, is a reversible inhibitor of β-lactamase. Nafcillin exhibits bactericidal activity, and can be used for the research of staphylococcal infections.
  • HY-17589
    Chloroquine phosphate

    Parasite Autophagy SARS-CoV Toll-like Receptor (TLR) HIV Antibiotic Cancer Infection Inflammation/Immunology
    Chloroquine phosphate is an antimalarial and anti-inflammatory agent widely used to treat malaria and rheumatoid arthritis. Chloroquine phosphate is an autophagy and toll-like receptors (TLRs) inhibitor. Chloroquine phosphate is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC50=1.13 μM).
  • HY-17589B
    Chloroquine dihydrochloride

    Parasite Autophagy SARS-CoV Toll-like Receptor (TLR) HIV Antibiotic Cancer Infection Inflammation/Immunology
    Chloroquine dihydrochloride is an antimalarial and anti-inflammatory agent widely used to treat malaria and rheumatoid arthritis. Chloroquine dihydrochloride is an autophagy and toll-like receptors (TLRs) inhibitor. Chloroquine dihydrochloride is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC50=1.13 μM).
  • HY-17589A
    Chloroquine

    Parasite Autophagy SARS-CoV Toll-like Receptor (TLR) HIV Antibiotic Cancer Infection Inflammation/Immunology
    Chloroquine is an antimalarial and anti-inflammatory agent widely used to treat malaria and rheumatoid arthritis. Chloroquine is an autophagy and toll-like receptors (TLRs) inhibitor. Chloroquine is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC50=1.13 μM).
  • HY-147240
    Acloproxalap

    Others Infection Inflammation/Immunology Cardiovascular Disease
    Acloproxalap is a quinoline-based aldehyde scavenger that can be used in studies of diseases with toxic aldehyde accumulation, such as inflammatory diseases of the eye and skin, respiratory diseases such as pneumonia, organ diseases, and viral infection-related syndromes.
  • HY-B1282A
    Sulfaquinoxaline sodium salt

    Bacterial Parasite Antibiotic Infection
    Sulfaquinoxaline sodium salt is an antimicrobial for veterinary use, with activity against a broad spectrum of Gram-negative and Gram-positive bacteria. Sulfaquinoxaline is used to prevent coccidiosis and bacterial infections.
  • HY-B1282
    Sulfaquinoxaline

    Bacterial Parasite Antibiotic Infection
    Sulfaquinoxaline is an antimicrobial for veterinary use, with activity against a broad spectrum of Gram-negative and Gram-positive bacteria. Sulfaquinoxaline is used to prevent coccidiosis and bacterial infections.
  • HY-B0277A
    Vidarabine phosphate

    ara-AMP; ara-A 5'-monophosphate

    HBV Antibiotic Infection
    Vidarabine phosphate (Ara-AMP), an antiviral agent, inhibits chronic HBV infection. Vidarabine phosphate also against herpes simplex and varicella zoster viruses.
  • HY-N2076
    Cephaeline hydrochloride

    (-)-Cephaeline hydrochloride; NSC 32944 monohydrochloride

    Influenza Virus Filovirus Infection
    Cephaeline hydrochloride ((-)-Cephaeline hydrochloride) is a phenolic alkaloid in Indian Ipecac roots. Cephaeline hydrochloride exhibits potent inhibition of both Zika virus (ZIKV) and Ebola virus (EBOV) infections.
  • HY-N7067
    Revaprazan hydrochloride

    Bacterial COX Infection
    Revaprazan hydrochloride is a novel acid pump antagonist (APA). Revaprazan hydrochloride reduces COX-2 expression and has significant anti-inflammatory actions activities in H. pylori infection.
  • HY-147808
    CXCR4 antagonist 7

    CXCR Infection Cancer Inflammation/Immunology
    CXCR4 antagonist 7 (Compound PARA-B) is a CXCR4 antagonist with the IC50 of 9.3 nM. CXCR4 antagonist 7 can be used for the research of HIV infection, inflammatory diseases, cancer, and WHIM syndrome.
  • HY-B0555BS
    Nafcillin-d5 sodium

    Antibiotic Infection
    Nafcillin-d5 sodium is the deuterium labeled Nafcillin sodium. Nafcillin sodium, an antibiotic, is a reversible inhibitor of β-lactamase. Nafcillin sodium can be used for the research of staphylococcal infections.
  • HY-P1222B
    LL-37, human acetate

    Bacterial Infection Inflammation/Immunology
    LL-37, human acetate is a 37-residue, amphipathic, cathelicidin-derived antimicrobial peptide, which exhibits a broad spectrum of antimicrobial activity. LL-37, human acetate could help protect the cornea from infection and modulates wound healing.
  • HY-B0395B
    Sitafloxacin monohydrate

    DU6859a monohydrate

    Bacterial Antibiotic Infection
    Sitafloxacin (DU6859a) monohydrate is a potent, orally active fluoroquinolone antibiotic. Sitafloxacin monohydrate shows antichlamydial activity and antibacterial activities against a broad range of gram-positive and gram-negative bacteria, including anaerobic bacteria, as well as against atypical pathogens. Sitafloxacin monohydrate can be used for the research of respiratory tract infection and urinary tract infection.
  • HY-N7123S
    Sulfacetamide-d4

    Sulphacetamide-d4

    Bacterial Antibiotic Infection
    Sulfacetamide-d4 (Sulphacetamide-d4) is the deuterium labeled Sulfacetamide. Sulfacetamide (Sulphacetamide), a bacteriostatic sulphonamide, is a popular antibiotic prescribed for treating ocular infections.
  • HY-B0330DS
    (R)-Ofloxacin-d3

    Bacterial Antibiotic Infection
    (R)-Ofloxacin-d3 is the deuterium labeled (R)-Ofloxacin. (R)-Ofloxacin (Dextrofloxacin) is an antibiotic useful for the treatment of a number of bacterial infections. Antibacterial activity.
  • HY-147411
    Ulonivirine

    MK-8507

    Reverse Transcriptase HIV Infection
    Ulonivirine (MK-8507) is an orally active non-nucleoside reverse transcriptase inhibitor with high antiviral activity. Ulonivirine can be used for the research of HIV-1 infection.
  • HY-P2036
    FSL-1

    Toll-like Receptor (TLR) Antibiotic Infection
    FSL-1, a bacterial-derived toll-like receptor 2/6 (TLR2/6) agonist, enhances resistance to experimental HSV-2 infection.
  • HY-147358
    Emitasvir diphosphate

    DAG181 diphosphate

    HCV Infection
    Emitasvir (DAG181) diphosphate is an orally active hepatitis C virus (HCV) nonstructural protein 5A (NS5A) inhibitor and can be used for research of chronic hepatitis C virus infection.
  • HY-78726S
    Fosamprenavir-d4

    Amprenavir phosphate-d4; GW 433908-d4

    HIV Endogenous Metabolite Infection
    Fosamprenavir-d4 is deuterium labeled Fosamprenavir. Fosamprenavir (Amprenavir phosphate;GW 433908) is a phosphate ester prodrug of the antiretroviral protease inhibitor Amprenavir, with improved solubility. Anti-HIV infection.
  • HY-10353AS
    Raltegravir-d3 potassium

    MK 0518-d3 potassium

    HIV Integrase HIV Infection
    Raltegravir-d3 potassium (MK 0518-d3 potassium) is the deuterium labeled Raltegravir potassium. Raltegravir (MK 0518) potassium is a potent integrase (IN) inhibitor, used to treat HIV infection.
  • HY-B1244S
    Dimetridazole-d3

    1,2-Dimethyl-5-nitroimidazole-d3

    Parasite Antibiotic Infection
    Dimetridazole-d3 (1,2-Dimethyl-5-nitroimidazole-d3) is a deuterium labeled Dimetridazole. Dmetridazole, a nitroimidazole-based antibiotic, combats protozoan infections.
  • HY-B1325
    Cefuroxime axetil

    Bacterial Antibiotic Infection
    Cefuroxime Axetil, a prodrug of the cephalosporin cefuroxime and an oarl broad spectrum antibiotic, inhibits several gram-positive and gram-negative organisms, including those most frequently associated with various common community-acquired infections.
  • HY-17426S
    Famciclovir-d4

    BRL 42810-d4

    HSV Infection
    Famciclovir-d4 (BRL 42810-d4) is the deuterium labeled Famciclovir. Famciclovir (BRL 42810) is a guanine analogue antiviral drug used for the treatment of various herpesvirus infections.
  • HY-B1043S
    Piromidic Acid-d5

    Bacterial Antibiotic Infection
    Piromidic Acid-d5 is the deuterium labeled Piromidic acid. Piromidic acid is an antibacterial agent. Piromidic acid is active against gramnegative bacteria and staphylococci and can be used for the research of intestinal, urinary, and biliary tract infections.
  • HY-104074
    Pocapavir

    SCH-48973; V-073

    Enterovirus Infection
    Pocapavir (SCH-48973) is an orally active capsid inhibitor. Pocapavir prevents virion uncoating upon entry into the cell. Pocapavir has antiviral activity against polioviruses. Pocapavir also inhibits enterovirus infections.
  • HY-B0035S
    Sulfamethazine-d4

    Sulfadimidine-d4; Sulfadimerazine-d4

    Bacterial Infection
    Sulfamethazine-D4 (Sulfadimidine-D4) is a deuterium labeled Sulfamethazine (Sulfadimidine). Sulfamethazine is an antimicrobial that is widely used to treat and prevent various animal diseases (such as gastrointestinal and respiratory tract infections).
  • HY-108675
    PPNDS tetrasodium

    MMP P2X Receptor Cancer Infection
    PPNDS tetrasodium is a selective and competitive meprin β inhibitor (IC50: 80 nM, Ki: 8 nM), and also inhibits ADAM10 (IC50: 1.2 μM). PPNDS tetrasodium is also a P2X1 receptor antagonist. PPNDS is an agonist for the ATP receptor of Paramecium. PPNDS tetrasodium potently inhibits polymerases from viruses. PPNDS tetrasodium can be used in the research of infection and cancers.
  • HY-B1282S
    Sulfaquinoxaline-d4

    Bacterial Parasite Antibiotic Infection
    Sulfaquinoxaline-D4 is the deuterium labeled Sulfaquinoxaline. Sulfaquinoxaline is an antimicrobial for veterinary use, with activity against a broad spectrum of Gram-negative and Gram-positive bacteria. Sulfaquinoxaline is used to prevent coccidiosis and bacterial infections.
  • HY-109137
    Selgantolimod

    GS-9688

    Toll-like Receptor (TLR) HBV Infection
    Selgantolimod (GS-9688) is an orally active, potent and selective toll-like receptor 8 (TLR8) agonist for the treatment of hepatitis B virus (HBV) and human immunodeficiency virus (HIV) infection.
  • HY-17460S
    Garenoxacin-d4

    Bacterial Infection
    Garenoxacin-d4 (BMS284756-d4) is the deuterium labeled Garenoxacin. Garenoxacin (BMS284756) is a quinolone antibiotic for the treatment of Gram-positive and Gram-negative bacterial infections.
  • HY-17506A
    Azithromycin hydrate

    CP-62993 dihydrate

    Bacterial Autophagy Antibiotic Infection
    Azithromycin hydrate is a macrolide antibiotic useful for the treatment of a number of bacterial infections.
  • HY-19952
    Pleconaril

    VP 63843; Win 63843

    Enterovirus Infection
    Pleconaril is a capsid inhibitor used previously to treat enterovirus infections.
  • HY-10353
    Raltegravir

    MK-0518

    HIV Integrase HIV Infection
    Raltegravir is a potent integrase (IN) inhibitor, used to treat HIV infection.
  • HY-B0337S2
    Sulfadimethoxine-13C6

    Sulphadimethoxine-13C6

    Bacterial Antibiotic Infection
    Sulfadimethoxine-13C6 (Sulphadimethoxine-13C6) is the 13C-labeled Sulfadimethoxine. Sulfadimethoxine (Sulphadimethoxine) is a sulfonamide antibiotic used to treat many infections.
  • HY-W250152
    Polycytidylic acid potassium

    Others Inflammation/Immunology
    Polycytidylic acid potassium is an immunostimulant and synthetic double-stranded RNA. Polycytidylic acid potassium can be used experimentally to model viral infections in vivo. Polycytidylic acid potassium is a common tool in immune system research.
  • HY-I0501
    2'-Aminoacetophenone

    Bacterial Inflammation/Immunology
    2'-Aminoacetophenone is an aromatic compound containing a ketone substituted by one alkyl group, and a phenyl group. 2'-Aminoacetophenone can be used as a breath biomarker for the detection of Ps. Aeruginosa infections in the cystic fibrosis lung.
  • HY-139903
    Antifungal agent 18

    Fungal Infection
    Antifungal agent 18 is a novel antifungal agent for the treatment of fungal infection.
  • HY-B1790
    Terconazole

    R42470

    Fungal Infection
    Terconazole is a broad-spectrum antifungal medication for the treatment of vaginal yeast infection.
  • HY-137453B
    (1R)-Tenofovir amibufenamide

    (1R)-HS-10234

    HBV HIV Infection
    (1R)-Tenofovir amibufenamide ((1R)-HS-10234) is the isomer of Tenofovir amibufenamide, is an orally active antiviral agent. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) is a HIV infection inhibitor and HBV infection inhibitor. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) can be used for HIV infections, hepatitis B research.
  • HY-W039454S
    2,4-Dichlorobenzyl alcohol-d2

    Bacterial Infection
    2,4-Dichlorobenzyl alcohol-d2 is the deuterium labeled 2,4-Dichlorobenzyl alcohol. 2,4-Dichlorobenzyl alcohol is a mild antiseptic, with a broad spectrum for bacterial and virus associated with mouth and throat infections.
  • HY-12641
    Pyrantel tartrate

    Parasite Antibiotic Infection
    Pyrantel tartrate, a tetrahydropyrimidine broad-spectrum anthelmintic, and is a nicotinic acetylcholine receptor (nAChR) agonist. Pyrantel tartrate can elicit spastic muscle paralysis in parasitic worms. Pyrantel tartrate can be used for the research of astrointestinal nematodes infections.
  • HY-18324
    CRS3123

    REP-3123

    Antibiotic Inflammation/Immunology
    CRS3123 is a potent and orally active narrow-spectrum antibiotic. CRS3123 inhibits bacterial methionyl-tRNA synthetase. CRS3123 has potent activity against Clostridium difficile (C. difficile) and aerobic Gram-positive bacteria but little activity against Gram-negative bacteria, including anaerobes. CRS3123 has the potential for the research of C. difficile infections.
  • HY-147237
    LpxC-IN-10

    Bacterial Infection
    LpxC-IN-10 (Compound A) is a high selectivity inhibitor of LpxC. LpxC-IN-10 exhibits MIC values of 0.5 μg/mL against E. coli and K. pneumoniae. LpxC-IN-10 (Compound A) can be used for the research of bacterial infection.
  • HY-10353A
    Raltegravir potassium

    MK 0518 potassium

    HIV Integrase HIV Infection
    Raltegravir (MK 0518) potassium is a potent integrase (IN) inhibitor, used to treat HIV infection.
  • HY-151421
    Chitin synthase inhibitor 11

    Fungal Cancer Infection
    Chitin synthase inhibitor 11 is a chitin synthase (CHS) inhibitor. Chitin synthase inhibitor 11 shows excellent CHS inhibitory activity with an IC50 value of 0.10 mM. Chitin synthase inhibitor 11 has broad-spectrum antifungal activity in vitro. Chitin synthase inhibitor 11 can be used for the research of invasive fungal infections (IFIs).
  • HY-N0248
    Saikosaponin B2

    HCV Cancer Infection
    Saikosaponin B2 is an active component from Bupleurum kaoi root, acts as an entry inhibitor against HCV infection. Anti-cancer activity.
  • HY-12640
    Pyrantel pamoate

    Pyrantel embonate

    Parasite Antibiotic Infection
    Pyrantel pamoate (Pyrantel embonate), a tetrahydropyrimidine broad-spectrum anthelmintic, is a nicotinic acetylcholine receptor (nAChR) agonist. Pyrantel pamoate can elicit spastic muscle paralysis in parasitic worms. Pyrantel pamoate can be used for the research of astrointestinal nematodes infections.
  • HY-111069
    Nifeviroc

    CCR HIV Infection Inflammation/Immunology
    Nifeviroc is an orally active CCR5 antagonist. Nifeviroc is used for the study of HIV type-1 infection.
  • HY-100500
    Lenampicillin hydrochloride

    KBT 1585 hydrochloride

    Bacterial Cancer
    Lenampicillin hydrochloride (KBT 1585 hydrochloride) is an orally active prodrug of Ampicillin and is an effective beta-lactam antibacterial agent that inhibits bacterial penicillin-binding proteins (transpeptidase). Lenampicillin hydrochloride has improved absorption and decreased side effects compares to Ampicillin and is applied in the investigation of the suppurative skin and soft tissue infection .
  • HY-B0671
    Vancomycin

    Bacterial Autophagy Antibiotic Infection Cancer
    Vancomycin is an antibiotic for the treatment of bacterial infections.
  • HY-107329
    Cefathiamidine

    Bacterial Antibiotic Infection
    Cefathiamidine is a first-generation cephalosporin antibacterial agent and is used to treat infections caused by susceptible bacteria. Cefathiamidine exhibits a wide spectrum of antimicrobial activity against bacteria. Cefathiamidine is used for the treatment of respiratory, liver, five senses, urinary tract infections, endocarditis and sepsis.
  • HY-143292
    Antibacterial agent 81

    Bacterial Infection
    Antibacterial agent 81 is a DNA transcription inhibitor. Antibacterial agent 81 inhibits S. aureus USA300 and M. smegmatis ATCC14468 with MIC values of 12.5 and 7.8 μM, respectively. Antibacterial agent 81 can be used for the research of infection.
  • HY-B0101B
    Fluconazole mesylate

    UK 49858 mesylate

    Fungal Antibiotic Infection
    Fluconazole (mesylate) is a triazole antifungal drug used in the treatment and prevention of superficial and systemic fungal infections.
  • HY-B0465
    Oxacillin sodium monohydrate

    Bacterial Antibiotic Infection
    Oxacillin sodium monohydrate is an antibiotic similar to Flucloxacillin used in resistant staphylococci infections study.
  • HY-B0101A
    Fluconazole hydrate

    UK 49858 hydrate

    Fungal Antibiotic Infection
    Fluconazole (hydrate) is a triazole antifungal drug used in the treatment and prevention of superficial and systemic fungal infections.
  • HY-17392
    Zalcitabine

    2',3'-Dideoxycytidine; ddC; Dideoxycytidine

    HIV Reverse Transcriptase Infection
    Zalcitabine is a potent nucleoside analogue reverse transcriptase inhibitor used in the treatment of HIV infection.
  • HY-N8221
    Homoembelin

    Bacterial Infection
    Homoembelin is an antimicrobial compound and has the potential for MDR bacterial infection research.
  • HY-B1381
    Cefixime

    FR-17027; FK-027; CL-284635

    Bacterial Antibiotic Infection
    Cefixime is an antibiotic and a third generation cephalosporin antibiotic, useful for the treatment of a number of bacterial infections.
  • HY-B1637
    Ditiocarb sodium

    Sodium diethyldithiocarbamate

    HIV Infection
    Ditiocarb sodium (Sodium diethyldithiocarbamate) is an accelerator of the rate of copper cementation. Sodium diethyldithiocarbamate reduces the incidence of HIV infection.
  • HY-14881A
    Bedaquiline fumarate

    R403323; TMC207 fumarate; R207910 fumarate

    Bacterial Antibiotic Infection
    Bedaquiline fumarate, a diarylquinoline antibiotic that targets ATP synthase, is effective for the treatment of Mycobacterium tuberculosis infections.
  • HY-142695
    Antibacterial synergist 1

    Bacterial Infection
    Antibacterial synergist 1 (compound 20P) is a bacterial biofilm inhibitor. Antibacterial synergist 1 inhibits the production of pyocyanin and biofilm formation with IC50s of 8.6 and 4.5 μM, respectively. Antibacterial synergist 1 has the potential for the research of P. aeruginosa infections.
  • HY-B1325S
    Cefuroxime axetil-d3

    Bacterial Antibiotic Infection
    Cefuroxime axetil-d3 is the deuterium labeled Cefuroxime axetil. Cefuroxime Axetil, a prodrug of the cephalosporin cefuroxime and an oarl broad spectrum antibiotic, inhibits several gram-positive and gram-negative organisms, including those most frequently associated with various common community-acquired infections.
  • HY-10353B
    Raltegravir sodium

    MK 0518 sodium

    HIV Integrase HIV Infection
    Raltegravir (MK 0518) sodium is a potent and orally active integrase (IN) inhibitor, used to treat HIV infection.
  • HY-B1056
    Procodazole

    Propazol; 2-Benzimidazolepropionic acid

    Bacterial Infection
    Procodazole is a non-specific active immunoprotective agent against viral and bacterial infections, used as a potentiator.
  • HY-B2186
    Piperazine adipate

    Parasite Infection
    Piperazine adipate is a potent broad spectrum anthelmintic against many common worm infections in mammals.
  • HY-N7934
    Trachelogenin

    (-)-Trachelogenin

    HCV Infection Inflammation/Immunology Neurological Disease
    Trachelogenin ((-)-Trachelogenin) is an HCV entry inhibitor without genotype specificity, and with low cytotoxicity. Trachelogenin inhibits HCVcc infection and HCVpp cell entry in a dose-dependent manner with an IC50 of 0.325 and 0.259 μg/mL in HCVcc and HCVpp models, respectively. Trachelogenin exhibits effective antiviral, anti-inflammatory and analgesic effects.
  • HY-B0136
    Cefdinir

    FK-482; CI-983

    Bacterial Antibiotic Infection
    Cefdinir (FK-482) is a semi-synthetic, broad-spectrum antibiotic in the third generation of the cephalosporin class, which is proved to be effective for infections caused by several Gram-negative and Gram-positive bacteria. Cefdinir can be used for the research of common bacterial infections of the ear, sinus, throat, and skin.
  • HY-B1381A
    Cefixime trihydrate

    FR-17027 trihydrate; FK-027 trihydrate; CL-284635 trihydrate

    Bacterial Antibiotic Infection Inflammation/Immunology
    Cefixime trihydrate (FR-17027 trihydrate) is an antibiotic and a third generation cephalosporin antibiotic, useful for the treatment of a number of bacterial infections.
  • HY-105284
    Sulopenem

    CP-70429

    Bacterial Infection
    Sulopenem (CP-70429) is an orally active, parenteral penem antibiotic with broad-spectrum activities against Gram-positive and Gram-negative bacteria. Sulopenem has the potential for urinary tract infections and intra-abdominal infections treatment. Sulopenem is inactive against Pseudomonas aeruginosa and Xanthomonas maltophilia.
  • HY-B1190
    Cefadroxil

    BL-S 578

    Bacterial Antibiotic Infection
    Cefadroxil is a broad-spectrum antibiotic of the cephalosporin type, effective in Gram-positive and Gram-negative bacterial infections.
  • HY-12639
    Bephenium

    Parasite Infection
    Bephenium is an anthelmintic agent formerly used in the treatment of hookworm infections and ascariasis; B-type AChR activator.
  • HY-B1360
    Chlorquinaldol

    Chloquinan

    Bacterial Fungal Antibiotic Infection
    Chlorquinaldol (Chloquinan) is a mono-hydroxyquinoline, is an antifungal and antibacterial, used for topical treatment of skin conditions and vaginal infections.
  • HY-100956
    Flurofamide

    Bacterial Infection
    Flurofamide is a potent bacterial urease inhibitor with potential in the treatment of infection induced urinary stones.
  • HY-20685
    Palmitoylethanolamide

    Palmidrol; Loramine P 256

    Influenza Virus Endogenous Metabolite Infection
    Palmitoylethanolamide (Palmidrol) is an active endogenous compound which can used for preventing virus infection of the respiratory tract.
  • HY-17506S
    Azithromycin-d3

    Bacterial Autophagy Antibiotic Infection Cancer
    Azithromycin-d3 (CP 62993-d3) is the deuterium labeled Azithromycin. Azithromycin (CP-62993) is a macrolide antibiotic useful for the treatment of a number of bacterial infections.
  • HY-B2033
    Pyrimethanil

    Fungal Infection
    Pyrimethanil is an anilinopyrimidine and broad-spectrum contact fungicide for the control of Botrytis spp. on a wide variety of crops. Pyrimethanil inhibits the biosynthesis of methionine and other amino acids in Botrytis cinerea. Pyrimethanil can be used for the research of fungal diseases prevention on fruit, vegetable and ornamental plants with mold infection.
  • HY-12639A
    Bephenium (hydroxynaphthoate)

    Parasite Infection
    Bephenium hydroxynaphthoate is an anthelmintic agent formerly used in the treatment of hookworm infections and ascariasis; B-type AChR activator.
  • HY-119826
    Quinfamide

    WIN-40014

    Parasite Infection
    Quinfamide is an antiamebic agent. Quinfamide has the potential to treat tropical parasitic infections such as Amoebiasis and Helminthiasis.
  • HY-109056
    Elsulfavirine

    HIV Infection
    Elsulfavirine is a reverse transcriptase inhibitors for HIV-1 infection and is a new anti-HIV drug.
  • HY-107801
    Inosine pranobex

    Imunovir; Delimmun; Groprinosin

    HIV Infection
    Inosine pranobex is a potent, broad-spectrum antiviral compound for HIV infection. Inosine pranobex is an immunopotentiator.
  • HY-139679
    Antibacterial agent 28

    Bacterial Infection
    Antibacterial agent 28 is a potential antibacterial candidate for combating MRSA infections (MICs = 0.5–2 μg/mL).
  • HY-B1235
    Acetohydroxamic acid

    AHA

    Bacterial Infection
    Acetohydroxamic acid is a potent and irreversible inhibitor of bacterial and plant urease and also used as adjunctive therapy in chronic urinary infection.
  • HY-B0593
    Ceftazidime

    GR20263

    Bacterial Antibiotic Infection
    Ceftazidime (GR20263), an antibiotic, has a broad spectrum activity against Gram-positive and Gram-negative aerobic bacteria. Ceftazidime is also active against Enterobacteriaceae (including β-lactamase-positive strains) and is resistant to hydrolysis by most β-lactamases.
  • HY-B0239
    Chloramphenicol

    Antibiotic Bacterial HIF/HIF Prolyl-Hydroxylase VEGFR Autophagy Apoptosis Beclin1 JNK Akt MMP Cancer Infection
    Chloramphenicol is an orally active, potent and broad-spectrum antibiotic. Chloramphenicol shows antibacterial activity. Chloramphenicol represses the oxygen-labile transcription factor and hypoxia inducible factor-1 alpha (HIF-1α) in hypoxic A549 and H1299 cells. Chloramphenicol suppresses the mRNA levels of vascular endothelial growth factor (VEGF) and glucose transporter 1, eventually decreasing VEGF release. Chloramphenicol can be used for anaerobic infections and lung cancer research.
  • HY-N7071A
    Maduramicin ammonium

    Maduramycin ammonium

    Bacterial Apoptosis Antibiotic Infection
    Maduramicin ammonium (Maduramycin ammonium) is isolated from the actinomycete Actinomadura rubra. Maduramicin ammonium (Maduramycin ammonium) is an anticoccidial agent for the the treatment of Eimeria spp., E. adenoeides, E. gallopavonis, and E. dispersa infection. Maduramicin ammonium (Maduramycin ammonium) induces cell apoptosis in chicken myocardial cells via intrinsic and extrinsic pathways.
  • HY-19773
    β-Lactamase-IN-1

    Bacterial Infection
    β-Lactamase-IN-1 is an inhibitor of β-Lactamase extracted from patent WO2016027249A1, page 77. β-Lactamase-IN-1 can be used to prepare of tricyclic nitrogen containing compound. β-Lactamase-IN-1 can be used for the research of neisseria gonorrhea infection.
  • HY-A0107
    Tetracycline

    Bacterial Antibiotic Infection Cancer
    Tetracycline is a broad-spectrum antibiotic with oral activity. Tetracycline exhibits activity against a wide range of bacteria including gram-positive, gram-negative bacteria, chlamydiae, mycoplasmas and rickettsiae. Tetracycline can be used for the research of infections.
  • HY-151420
    Chitin synthase inhibitor 10

    Fungal Cancer Infection
    Chitin synthase inhibitor 10 is a chitin synthase (CHS) inhibitor. Chitin synthase inhibitor 10 shows excellent CHS inhibitory activity with an IC50 value of 0.11 mM. Chitin synthase inhibitor 10 also is an antifungal agent and has significantly antifungal activity against drug-resistant fungal variants, such as C. albicans and C. neoformans. Chitin synthase inhibitor 10 can be used for the research of invasive fungal infections (IFIs).
  • HY-17506
    Azithromycin

    CP 62993

    Bacterial Autophagy Antibiotic Infection Cancer
    Azithromycin is a macrolide antibiotic useful for the treatment of a number of bacterial infections.
  • HY-B0318A
    Metronidazole hydrochloride

    SC 326421

    Antibiotic Bacterial Parasite Apoptosis Infection Inflammation/Immunology
    Metronidazole hydrochloride (SC 326421) is an orally active nitroimidazole antibiotic, can be used to research anaerobic infections. Metronidazole hydrochloride can cross blood brain barrier and results inflammation and skeletal muscle contraction under long-term application.
  • HY-10353S
    Raltegravir-d4

    HIV Integrase HIV Infection
    Raltegravir-d4 is deuterium labeled Raltegravir. Raltegravir is a potent integrase (IN) inhibitor, used to treat HIV infection.
  • HY-146328
    PqsR/LasR-IN-2

    Bacterial Infection
    The compound has shown clinical potential in the treatment of Pseudomonas aeruginosa (PA) - induced infections in a number of in vitro and in vivo studies.
  • HY-U00181
    Fludazonium chloride

    R23633

    Fungal Infection
    Fludazonium chloride (R23633) is an anti-fungal agent, which can be used in the treatment and prevention of superficial and systemic fungal infections.
  • HY-122123
    S-6123

    Bacterial Infection
    S-6123 is a potent antimicrobial compound of the oxazolidinone series. S-6123 inhibits ribosomal protein synthesis without inhibiting DNA or RNA synthesis.
  • HY-151422
    Chitin synthase inhibitor 12

    Others Cancer Infection
    Chitin synthase inhibitor 12 is a chitin synthase (CHS) inhibitor. Chitin synthase inhibitor 12 shows excellent CHS inhibitory activity with an IC50 value of 0.16 mM. Chitin synthase inhibitor 12 also is a broad-spectrum antifungal agent and has significantly antifungal activity against drug-resistant fungal variants, such as C. albicans and C. neoformans. Chitin synthase inhibitor 12 can be used for the research of invasive fungal infections (IFIs).
  • HY-N2925
    β-Amyrone

    β-Amyron

    Fungal COX PPAR Infection Metabolic Disease Inflammation/Immunology
    β-Amyrone (β-Amyron) is a triterpene compound which has anti-inflammatory activity through inhibiting the expression of COX-2. β-Amyrone has antifungal activity , as well as antiviral activity against Chikungunya virus. β-Amyrone also inhibits α-glucosidase and acetylcholinesterase (AChE) activity. β-Amyrone can be used in the research of disease like inflammation, infection, and obesity.
  • HY-125747
    Actinomycin X2

    Actinomycin V

    Bacterial Cancer Infection
    Actinomycin X2 (Actinomycin V), produced by many Streptomyces sp., shows strong inhibition of MRSA with a minimum inhibitory concentration (MIC) value of 0.25 μg/mL. Actinomycin X2 can be used for cancer and bacterial infection.
  • HY-B1159
    Nitroxoline

    8-Hydroxy-5-nitroquinoline; 5-Nitro-8-quinolinol

    Bacterial Autophagy Antibiotic Infection Cancer
    Nitroxoline is an antibiotic that has proven to be very effective at combating biofilm infections.
  • HY-B1366
    Meclocycline Sulfosalicylate Salt

    Bacterial Antibiotic Infection
    Meclocycline Sulfosalicylate Salt is a tetracycline antibiotic with broad-spectrum antibacterial activities, preventing skin bacterial infections such as acne vulgaris.
  • HY-U00131
    Sulfabrom

    N 3517; Sulfabromomethazine

    Bacterial Infection
    Sulfabrom (N 3517; Sulfabromomethazine) is a long-acting Sulfonamide that is used for the treatment of coccidiosis and various bacterial infections in the poultry, swine and cattle.
  • HY-17591
    Penicillin G potassium

    Benzylpenicillin potassium

    Bacterial Antibiotic Infection
    Penicillin G potassium is a fast-acting antibiotic; used to treat bacterial infections that affect the blood, heart, lungs, joints, and genital areas.
  • HY-128722
    HIV-1 inhibitor-3

    HIV Infection
    HIV-1 inhibitor-3 is a HIV infection inhibitor extracted from patent US2018360927.
  • HY-N3373
    Loganetin

    Bacterial Infection
    Loganetin is a non-toxic natural product that may be applied in the antibacterial drug development for treating multidrug-resistant Gram negative infections.
  • HY-P1407
    Z-VRPR-FMK TFA

    VRPR

    MALT1 Influenza Virus Cancer Infection
    Z-VRPR-FMK (TFA) (VRPR), a tetrapeptide, is a selective and irreversible MALT1 (Mucosa-associated lymphoid tissue lymphoma translocation protein 1) inhibitor. Z-VRPR-FMK (TFA) can protect against influenza A virus (IAV) infection.
  • HY-B0318
    Metronidazole

    Bacterial Parasite Apoptosis Antibiotic Cancer Infection Inflammation/Immunology
    Metronidazole is an orally active nitroimidazole antibiotic, can be used to research anaerobic infections. Metronidazole can cross blood brain barrier and results inflammation and skeletal muscle contraction under long-term application.
  • HY-17427
    Emtricitabine

    BW1592

    HIV Reverse Transcriptase Infection
    Emtricitabine is a nucleoside reverse transcriptase inhibitor (NRTI) with an EC50 of 0.01 µM in PBMC cell. It is an antiviral drug for the treatment of HIV infection.
  • HY-B1148A
    Furaltadone

    Altafur

    Bacterial Infection
    Furaltadone, a nitrofuran drug, has the potential for the study in infections of chickens with salmonella enteritidis. Furaltadone is inhibitory and bactericidal in vitro for staphylococci .
  • HY-14957
    Ozenoxacin

    T-3912

    Bacterial Infection
    Ozenoxacin is a nonfluorinated quinolone antibacterial, which shows potent activities against the main microorganisms isolated from skin and soft tissue infections.
  • HY-N2381
    Menthone

    Parasite Infection Inflammation/Immunology
    Menthone, a monoterpene extracted from plants and Mentha oil with strong antioxidant properties. Menthone is a main volatile component of the essential oil, and has anti-Inflammatory properties in Schistosoma mansoni Infection.
  • HY-131337
    RhlR antagonist 1

    Bacterial Infection
    RhlR antagonist 1 is a potent RhlR antagonist with an IC50 of 26 μM. RhlR antagonist 1 displays selective RhlR antagonism over LasR and PqsR, strong inhibition of biofilm formation in static and dynamic settings, and reduces production of virulence factors such as rhamnolipid and pyocyanin in P. aeruginosa. RhlR antagonist 1 can be utilized for developing QS-modulating molecules in the control of P. aeruginosa infections.
  • HY-19925
    AIC-292

    HIV Infection
    AIC-292 is a potent and selective inhibitor of HIV-1 nonnucleoside reverse transcriptase. AIC-292 inhibits wild-type HIV-1 laboratory strains at low nanomolar concentrations. AIC-292 displays potent antiviral in vivo efficacy in a mouse xenograft model. AIC-292 has the potential for the research of HIV-1 infection.
  • HY-B0510C
    Trimethoprim lactate

    Antifolate Bacterial Antibiotic Infection
    Trimethoprim lactate is a bacteriostatic antibiotic and an orally active dihydrofolate reductase inhibitor. Trimethoprim lactate is active against a wide range of Gram-positive and Gram-negative aerobic bacteria. Trimethoprim lactate has the potential for the research of urinary tract infections, Shigellosis and Pneumocystis pneumonia. Trimethoprim lactate can inhibit infection of Influenza A virus in chick embryo when combinated with zinc.
  • HY-B0510A
    Trimethoprim sulfate

    Antifolate Bacterial Antibiotic Influenza Virus Infection
    Trimethoprim sulfate is a bacteriostatic antibiotic and an orally active dihydrofolate reductase inhibitor. Trimethoprim sulfate is active against a wide range of Gram-positive and Gram-negative aerobic bacteria. Trimethoprim sulfate has the potential for the research of urinary tract infections, Shigellosis and Pneumocystis pneumonia. Trimethoprim sulfate can inhibit infection of Influenza A virus in chick embryo when combinated with zinc.
  • HY-136606
    SARS-CoV MPro-IN-1

    SARS-CoV Infection
    SARS-CoV MPro-IN-1 is a SARS-CoV-2 3CLpro covalent inhibitor, with an IC50 of 40 nM. SARS-CoV MPro-IN-1 shows good anti-SARS-CoV-2-infection activity in cell culture with an EC50 of 0.33 μM. SARS-CoV MPro-IN-1 has the potential for COVID-19 research.
  • HY-119726
    Fosmanogepix

    APX001; E1211

    Fungal Infection
    Fosmanogepix (APX001) is a first-in-class and orally available broad-spectrum antifungal agent, which targets the highly conserved Gwt1 fungal enzyme. Fosmanogepix (APX001) is an N-phosphonooxymethyl prodrug which is rapidly and completely metabolized by systemic alkaline phosphatases to the active moiety, APX001A. Fosmanogepix (APX001) can be used in development for the treatment of invasive fungal infections.
  • HY-N7453
    Fengycin

    Fungal Antibiotic Infection
    Fengycin is a cyclic lipopeptide used as an agricultural fungicide. Fengmycin has an anti-fungal infection effect by damaging the target's cell membrane.
  • HY-119893
    Diamfenetide

    Parasite Infection
    Diamfenetide is used for the study of Fasciola hepatica infections in vitro. Diamfenetide leads to irreversible paralysis in vitro of immature and adult Fasciola hepatica.
  • HY-B0322
    Sulfamethoxazole

    Ro 4-2130

    Bacterial Antibiotic Infection
    Sulfamethoxazole (Ro 4-2130) is a sulfonamide bacteriostatic antibiotic, used for bacterial infections. Sulfonamides is a competitive antagonists of para-aminobenzoic acid (PABA).
  • HY-U00160
    SP187

    MON-​DNJ; UV4

    Influenza Virus Infection
    SP187 is a host-targeted iminosugar with activity against filovirus infections in vitro and in vivo. SP187 is active against influenza and dengue in vivo.
  • HY-A0062
    Telithromycin

    HMR3647; RU66647

    Bacterial Antibiotic Infection Inflammation/Immunology
    Telithromycin (HMR3647) is a novel ketolide antibiotic that structurally resembles macrolides. Telithromycin belongs to the ketolide family that is characterized by a keto group at position 3 of the macrolide ring and is active against bacteria causing community-acquired pneumonia, acute exacerbation of chronic bronchitis, and acute sinusitis. Telithromycin also has similar immunomodulatory effects as macrolides. Telithromycin can be used for the research of respiratory infections including bronchial asthma.
  • HY-P2036A
    FSL-1 TFA

    Toll-like Receptor (TLR) MMP HSV Antibiotic Infection
    FSL-1 TFA, a bacterial-derived toll-like receptor 2/6 (TLR2/6) agonist, enhances resistance to experimental HSV-2 infection. FSL-1 TFA induces MMP-9 production through TLR2 and NF-κB/AP-1 signaling pathways in monocytic THP-1 cells.
  • HY-A0256
    Clavulanic acid

    Antibiotic Bacterial Infection Inflammation/Immunology
    Clavulanic acid is a naturally occurring powerful bacterial β-lactamases inhibitor for research of infections caused by bacteria, including infections of the ears. Clavulanic acid is active against a wide spectrum of gram-positive and gram-negative bacterias.
  • HY-B0914A
    10-Undecenoic acid zinc salt

    Zinc undecylenate

    Fungal Antibiotic Infection
    10-Undecenoic acid zinc salt is a natural or synthetic fungistatic fatty acid, is used topically in creams against fungal infections, eczemas, ringworm, and other cutaneous conditions.
  • HY-B1924
    Norvancomycin hydrochloride

    Desmethyl-vancomycin hydrochloride

    Bacterial Infection
    Norvancomycin hydrochloride is applicable for endocarditis, osteomyelitis, pneumonia, sepsis or soft tissue infections caused by Staphylococcus (including Methicillin-resistant strains and multidrug-resistant microbial strains).
  • HY-A0097
    Teicoplanin

    Antibiotic MDL-507; MDL-507

    Bacterial Antibiotic Infection
    Teicoplanin is a glycopeptide antibiotic used in the prophylaxis and treatment of serious infections caused by Gram-positive bacteria, including Methicillin-resistant Staphylococcus aureus and Enterococcus faecalis.
  • HY-100096
    Emtricitabine S-oxide

    Emtricitabine sulfoxide; Emtricitabine Degradant-III

    HIV Reverse Transcriptase Infection
    Emtricitabine S-oxide (Emtricitabine sulfoxide) is a major degradation product of Emtricitabine. Emtricitabine is a potent nucleoside reverse transcriptase inhibitor used for the treatment of HIV infection.
  • HY-P2123A
    Colistin A sulfate hydrate

    Bacterial Antibiotic Infection
    Colistin A sulfate hydrate is a major component of Colistin. Colistin is a polymyxin antibiotic and can be used to combat infections caused by problematic gram-negative bacteria.
  • HY-15256
    Faldaprevir

    BI 201335

    HCV Protease Infection
    Faldaprevir (BI 201335) is a potent, orally active and selective noncovalent inhibitor of NS3/4A protease of HCV (hepatitis C virus) genotypes 1a and 1b, with Ki values of 2.6 and 2.0 nM, respectively. Faldaprevir inhibits HCV RNA replication, with EC50 values of 6.5 and 3.1 nM, respectively. Faldaprevir has potent antiviral activity against chronic HCV infection.
  • HY-A0241
    Dalfopristin

    RP54476

    Bacterial Antibiotic Infection
    Dalfopristin is a semi-synthetic streptogramin antibiotic. Quinupristin/Dalfopristin (Q/D) is a valuable alternative antibiotic to vancomycin for the treatment of multi-drug resistant Enterococcus faecium infections.
  • HY-132598
    Miravirsen

    SPC-3649

    MicroRNA Infection Inflammation/Immunology
    Miravirsen (SPC-3649), a β-d-oxy-locked nucleic acid-modified phosphorothioate antisense oligonucleotide, inhibit the biogenesis of miR-122. Miravirsen (SPC-3649) is used in the study for HCV infections.
  • HY-B0974
    Methicillin sodium salt

    Meticillin sodium

    Bacterial Antibiotic Infection
    Methicillin sodium salt (Meticillin sodium) is a β-lactam, semi-synthetic antibiotic related to penicillin antibiotic. Methicillin sodium salt inhibits penicillin-binding proteins involved in the synthesis of peptidoglycan. Methicillin sodium salt inhibits S. aureus with a MIC value of 2.1 μg/ml. Methicillin sodium salt can be used for the research of inflammation.
  • HY-17624
    Framycetin

    Neomycin B; Fradiomycin B

    Bacterial Antibiotic Infection
    Framycetin (Neomycin B), an aminoglycoside antibiotic, is a potent RNase P cleavage activity inhibitor with a Ki of 35 μM. Framycetin competes for specific divalent metal ion binding sites in RNase P RNA. Framycetin inhibits hammerhead ribozyme with a Ki of 13.5 μM. Framycetin, a 5″-azido neomycin B precursor, binds the Drosha site in miR-525 and is used for hepatic encephalopathy and enteropathogenic E. coli infections.
  • HY-139056
    SU0268

    Others Cancer Infection Inflammation/Immunology
    SU0268 is a potent and specific inhibitor of 8-Oxoguanine DNA glycosylase 1 (OGG1). SU0268 regulates inflammatory responses during Pseudomonas aeruginosa infection.
  • HY-W049875
    Nitroxynil

    Parasite Infection
    Nitroxynil, anthelmintic agent, is active against parasites in both adult and immature stages. Nitroxynil is widely used for the research of infection of Fasciola hepatica.
  • HY-151102
    Fabimycin

    Antibiotic Bacterial Infection
    Fabimycin is a FabI inhibitor with potent antibacterial activity against gram-negative bacteria. Fabimycin is effective against drug-resistant gram-negative Infections in vivo.
  • HY-N10194
    P-orlandin

    Parasite Endogenous Metabolite Infection
    P-orlandin, a fungal metabolite, prevents FREP1 from binding to gametocytes or ookinetes. P-orlandin effectively inhibits P. falciparum infection in mosquitoes.
  • HY-17413
    Zidovudine

    Azidothymidine; AZT; ZDV

    HIV CRISPR/Cas9 Infection
    Zidovudine is a nucleoside reverse transcriptase inhibitor (NRTI), widely used to treat HIV infection. Zidovudine increases CRISPR/Cas9-mediated editing frequency.
  • HY-B0299
    Oxibendazole

    Parasite Apoptosis Infection
    Oxibendazole is an effective benzimidazole anthelmintic and is against nema-tode infections. Oxibendazole can induces apoptosis and has anti-cancer and anti-inflammation activities.
  • HY-N6680
    Virginiamycin S1

    Bacterial Antibiotic Infection
    Virginiamycin S1 is a cyclic hexadepsipeptide antibiotic, inhibits bacterial protein synthesis at the level of aminoacyl-tRNA binding and peptide bond formation. Virginiamycin S1 belongs to the type B compounds in the streptogramin family and is produced by Streptomyces virginiae, shows a strong bactericidal activity against a wide range of Gram-positive bacteria. Virginiamycin S1 together with virginiamycin M1 is more effective in treat multidrug-resistant bacterial infections[1][2].
  • HY-139602
    (+)-JNJ-A07

    Virus Protease Infection
    (+)-JNJ-A07 is a highly potent, orally active pan-serotype dengue virus inhibitor targeting the NS3-NS4B interaction. (+)-JNJ-A07 exerts nanomolar to picomolar activity against a panel of 21 clinical isolates. (+)-JNJ-A07 has a favourable pharmacokinetic profile that results in outstanding efficacy against dengue virus infection in mouse infection models.
  • HY-N6798
    Myriocin

    HCV Antibiotic Infection
    Myriocin, a fungal metabolite isolated from Myriococcum albomyces, Isaria sinclairi and Mycelia sterilia, is a potent inhibitor of serine-palmitoyl-transferase (SPT) and a key enzyme in de novo synthesis of sphingolipids. Myriocin strongly suppresses replication of both the subgenomic HCV-1b replicon and the JFH-1 strain of genotype 2a infectious HCV, with an IC50 of 3.5 µg/mL for inhibiting HCV infection.
  • HY-17624A
    Framycetin sulfate

    Neomycin B sulfate; Fradiomycin B sulfate

    Antibiotic Bacterial Infection
    Framycetin sulfate (Neomycin B sulfate), an aminoglycoside antibiotic, is a potent RNase P cleavage activity inhibitor with a Ki of 35 μM. Framycetin sulfate competes for specific divalent metal ion binding sites in RNase P RNA. Framycetin sulfate inhibits hammerhead ribozyme with a Ki of 13.5 μM. Framycetin sulfate, a 5″-azido neomycin B precursor, binds the Drosha site in miR-525 and is used for hepatic encephalopathy and enteropathogenic E. coli infections.
  • HY-112258
    IMP-1088

    DNA/RNA Synthesis Infection
    IMP-1088 is a potent human N-myristoyltransferases NMT1 and NMT2 dual inhibitor with IC50s of <1 nM for HsNMT1 and HsNMT2. IMP-1088 has a Kd of <210 pM for HsNMT1. IMP-1088 efficiently blocks rhinovirus replication by blocking rhinovirus virus-encoded protein (VP0) N-myristoylation. IMP-1088 protects host cells from the cytotoxic effects of viral infection.
  • HY-B1906
    Streptomycin

    Agrept; Agrimycin; Streptomycin A

    Antibiotic Bacterial Infection Neurological Disease
    Streptomycin (Agrept) is an effective antibiotic against M. tuberculosis, is used for the research of tuberculosis (TB). Streptomycin also is a bacteriocidal agent that can be used for the research of a number of bacterial infections. Streptomycin can bind strongly to nucleic acids, interferes and blocks protein synthesis while permitting continued RNA and DNA synthesis. Streptomycin, as a common antibiotic used in culture media, also is a blocker of stretch-activated and mechanosensitive ion channels in neurons and cardiac myocytes .
  • HY-B0441
    Tobramycin

    Nebramycin Factor 6; Deoxykanamycin B

    Bacterial Antibiotic Infection
    Tobramycin (Nebramycin Factor 6) is a parenterally administered, broad spectrum aminoglycoside antibiotic that is widely used in the treatment of moderate to severe bacterial infections due to sensitive organisms.
  • HY-W035409
    RPW-24

    Bacterial Infection
    RPW-24 protects C. elegans from bacterial infection by stimulating the host immune response of the nematode. RPW-24 has antibacterial activity.
  • HY-N7123S1
    Sulfacetamide-13C6

    Sulphacetamide-13C6

    Bacterial Antibiotic Infection
    Sulfacetamide-13C6 is the 13C6 labeled Sulfacetamide. Sulfacetamide (Sulphacetamide), a bacteriostatic sulphonamide, is a popular antibiotic prescribed for treating ocular infections.
  • HY-W040128
    Kanamycins sulfate

    Antibiotic Bacterial Infection
    Kanamycins sulfate is a broad-spectrum antibiotic, can be used in certain severe staphylococcal or Gram-negative bacillary infections. Kanamycin sulfate has certain ototoxicity.
  • HY-N2381S
    Menthone-d3

    Parasite Infection Inflammation/Immunology
    Menthone-d3 is the deuterium labeled Menthone. Menthone, a monoterpene extracted from plants and Mentha oil with strong antioxidant properties. Menthone is a main volatile component of the essential oil, and has anti-Inflammatory properties in Schistosoma mansoni Infection.
  • HY-B0593A
    Ceftazidime pentahydrate

    GR20263 pentahydrate

    Bacterial Antibiotic Infection Cancer
    Ceftazidime (GR20263) pentahydrate , an antibiotic, has a broad spectrum activity against Gram-positive and Gram-negative aerobic bacteria. Ceftazidime pentahydrate is also active against Enterobacteriaceae (including β-lactamase-positive strains) and is resistant to hydrolysis by most β-lactamases.
  • HY-P2076
    Dusquetide

    SGX942

    Bacterial Cancer Infection
    Dusquetide (SGX942) is a first-in-class innate defense regulator (IDR). Dusquetide modulates the innate immune response to both PAMPs and DAMPs by binding to p62. Dusquetide shows activity in both reducing inflammation and increasing clearance of bacterial infection. DAMPs: damage-associated molecular patterns; PAMPs: pathogen-associated molecular patterns
  • HY-B1790S
    Terconazole-d4

    R42470-d4

    Fungal Infection
    Terconazole-d4 (R42470-d4) is the deuterium labeled Terconazole. Terconazole is a broad-spectrum antifungal medication for the treatment of vaginal yeast infection.
  • HY-144252
    Antibacterial agent 69

    ROS Kinase Infection
    Antimicrobial agent 69 is a novel structural antimicrobial regulator and has been used to fight deadly multidrug-resistant bacterial infections, and its < b > MICs < / b > value is 2.978 μM。
  • HY-B0439
    Sulfadoxine

    Sulphadoxine

    Parasite HIV Antibiotic Infection
    Sulfadoxine(Sulphadoxine) is a long acting sulfonamide that is used, usually in combination with other drugs, for respiratory, urinary tract and malarial infections. Sulfadoxine inhibits HIV replication in peripheral blood mononuclear cells.
  • HY-146417
    Antiviral agent 19

    Influenza Virus Infection
    Antiviral agent 19 (Compound 3) is a selective inhibitor against Zika virus infection with an EC50 of 1.3 µM. Antiviral agent 19 has low cytotoxicity.
  • HY-90001
    Ritonavir

    ABT 538; RTV

    HIV Protease HIV SARS-CoV Apoptosis Infection
    Ritonavir (ABT 538) is an inhibitor of HIV protease used to treat HIV infection and AIDS. Ritonavir is also a SARS-CoV 3CL pro inhibitor with an IC50 of 1.61 μM.
  • HY-B2033S
    Pyrimethanil-13C,15N2

    Fungal Infection
    Pyrimethanil-13C,15N2 is the 13C-labeled and 15N-labeled Pyrimethanil. Pyrimethanil is an anilinopyrimidine and broad-spectrum contact fungicide for the control of Botrytis spp. on a wide variety of crops. Pyrimethanil inhibits the biosynthesis of methionine and other amino acids in Botrytis cinerea. Pyrimethanil can be used for the research of fungal diseases prevention on fruit, vegetable and ornamental plants with mold infection.
  • HY-150699
    TXA6101

    Bacterial Infection
    TXA6101 is a bacterial protein FtsZ (filamentous temperature-sensitive protein Z) inhibitor that inhibits bacterial division. TXA6101 has antimicrobial activity against MRSA isolates expressing either the G193D or G196S mutant FtsZ with the MIC value of 1 μg/mL, retains significant activity against the TXA707-resistant FtsZ mutant. TXA6101 can be used as a potential method against Gram-negative bacterial infections.
  • HY-P2076A
    Dusquetide TFA

    SGX942 TFA

    Bacterial Cancer Infection
    Dusquetide (SGX942) TFA is a first-in-class innate defense regulator (IDR). Dusquetide TFA modulates the innate immune response to both PAMPs and DAMPs by binding to p62. Dusquetide TFA shows activity in both reducing inflammation and increasing clearance of bacterial infection. DAMPs: damage-associated molecular patterns; PAMPs: pathogen-associated molecular patterns
  • HY-121268
    Demeclocycline

    Antibiotic Bacterial Cancer Infection Inflammation/Immunology
    Demeclocycline is an orally active tetracycline antibiotic. Demeclocycline impairs protein synthesis by binding to the 30S ribosomal subunit to inhibit binding of aminoacyl tRNA. Demeclocycline shows anti-bacterial activitise to a wide variety of bacterial infections.
  • HY-B0441A
    Tobramycin sulfate

    Nebramycin Factor 6 sulfate; Deoxykanamycin B sulfate

    Bacterial Antibiotic Infection
    Tobramycin sulfate (Nebramycin Factor 6 sulfate) is a parenterally administered, broad spectrum aminoglycoside antibiotic that is widely used in the treatment of moderate to severe bacterial infections due to sensitive organisms.
  • HY-17035
    Doramectin

    Parasite Antibiotic Infection
    Doramectin is a derivative of Ivermectin (HY-15310). Doramectin is a potent antiparasitic antibiotic. Doramectin is an active compound against S.mansoni in an NMRI mouse infection model.
  • HY-20685S
    Palmitoylethanolamide-d4

    Palmidrol-d4; Loramine P 256-d4

    Influenza Virus Endogenous Metabolite Infection
    Palmitoylethanolamide-d4 (Palmidrol-d4) is the deuterium labeled Palmitoylethanolamide. Palmitoylethanolamide (Palmidrol) is an active endogenous compound which can used for preventing virus infection of the respiratory tract.
  • HY-146418
    Antiviral agent 20

    Influenza Virus Infection
    Antiviral agent 20 (Compound 17b) is a selective inhibitor against Zika virus infection with an EC50 of 4.5 µM. Antiviral agent 20 has low cytotoxicity.
  • HY-129060
    Flutrimazole

    Fungal Infection
    Flutrimazole is an imidazole antifungal with dual anti-inflammatory and antifungal activity. Flutrimazole shows scarce transdermal penetration. Flutrimazole has the advantageous in the research of topical fungal infections with an inflammatory component.
  • HY-12888
    AZD5099

    Topoisomerase Bacterial Infection
    AZD5099, an antibacterial agent, is a potent and selective bacterial topoisomerase II inhibitor. AZD5099 potently inhibits the infections caused by Gram-positive and fastidious Gram-negative bacteria.
  • HY-A0281
    4-Phenylbutyric acid

    4-PBA; Benzenebutyric acid

    HDAC Virus Protease Cancer Infection
    4-Phenylbutyric acid (4-PBA) is an inhibitor of HDAC and endoplasmic reticulum (ER) stress, used in cancer and infection research.
  • HY-U00007
    Stilbamidine

    Ba 2652; Stilbamidin

    Fungal Cancer Infection
    Stilbamidine is a diamidine compound derived from Stilbene and used chiefly in the form of its crystalline isethionate salt in treating various fungal infections.
  • HY-B1636
    Dithiazanine iodide

    Parasite Infection
    Dithiazanine iodide is an effective broad-spectrum anthelmintic. Dithiazanine iodide can be used for the research of trichuriasis, strongyloidiasis, enterobiasis, ascariasis, and hookworm infection. Dithiazanine iodide is also a cyanine dye.
  • HY-B0147A
    Pefloxacin mesylate

    Pefloxacinium mesylate

    Bacterial Antibiotic Infection
    Pefloxacin mesylate is a an antibacterial agent and prevents bacterial DNA replication by inhibiting DNA gyrase (topoisomerse) Target: DNA gyrase Pefloxacin is a synthetic chemotherapeutic agent used to treat severe and life-threatening bacterial infections.
  • HY-B0957
    Erythromycin Ethylsuccinate

    Erythromycin ethyl succinate; EES

    Bacterial HIV Autophagy Antibiotic Infection
    Erythromycin Ethylsuccinate is an antibiotic useful for the treatment of a number of bacterial infections, has an antimicrobial spectrum similar to or slightly wider than that of penicillin. Erythromycin Ethylsuccinate has antiviral activity against HIV-1.
  • HY-B0147
    Pefloxacin

    Pefloxacinium

    Bacterial Antibiotic Infection
    Pefloxacin is a an antibacterial agent and prevents bacterial DNA replication by inhibiting DNA gyrase (topoisomerse) Target: DNA gyrase Pefloxacin is a synthetic chemotherapeutic agent used to treat severe and life-threatening bacterial infections.
  • HY-P1674A
    Murepavadin TFA

    POL7080 TFA

    Bacterial Antibiotic Infection
    Murepavadin (TFA), a 14-amino-acid cyclic peptide, is a highly potent, specific antibiotic for the treatment of bacterial infections caused by Pseudomonas aeruginosa. Murepavadin (TFA) targets the lipopolysaccharide transport portin D .
  • HY-136466
    A2ti-2

    Virus Protease HPV Infection
    A2ti-2 is a selective and low-affinity annexin A2/S100A10 heterotetramer (A2t) inhibitor with an IC50 of 230 μM. A2ti-2 specifically disrupts the protein-protein interaction (PPI) between A2 and S100A10. A2ti-2 prevents human papillomavirus type 16 (HPV16) infection.
  • HY-136465
    A2ti-1

    Virus Protease HPV Infection
    A2ti-1 is a selective and high-affinity annexin A2/S100A10 heterotetramer (A2t) inhibitor with an IC50 of 24 μM. A2ti-1 specifically disrupts the protein-protein interaction (PPI) between A2 and S100A10. A2ti-1 prevents human papillomavirus type 16 (HPV16) infection.
  • HY-16764
    Avarofloxacin

    JNJ-Q2

    Bacterial Infection Inflammation/Immunology
    Avarofloxacin (JNJ-Q2) is a broad-spectrum fluoroquinolone antibacterial drug being developed for the treatment of acute bacterial skin and skin-structure infections and community-acquired pneumonia. Avarofloxacin (JNJ-Q2) is an aminoethylidenylpiperidine fluoroquinolone that demonstrates antibacterial effect against numerous Gram-positive bacteria with a mean 0.12 mg/L MIC90 value. Avarofloxacin (JNJ-Q2) has potential for treatment of methicillin-resistant Staphylococcus aureus (MRSA) infections.
  • HY-145592
    Ruzotolimod

    Toll-like Receptor (TLR) Infection
    Ruzotolimod is the agonist of TLR7. Ruzotolimod has the potential for the research of HBV, COVID-19 or SARS-CoV-2 infection (extracted from patent WO2021130195A1).
  • HY-B1004
    Dinitolmide

    Zoalene

    Parasite Infection
    Dinitolmide (Zoalene), a fodder additive for poultry, has anti-coccidial effect. Dinitolmide can be used to prevent infections induced by Eimeria, such as Eimeria tenella, Eimeria necatrix, Eimeria brunette, and so on.
  • HY-B0147B
    Pefloxacin mesylate dihydrate

    Pefloxacinium mesylate dihydrate

    Bacterial Antibiotic Infection
    Pefloxacin mesylate dehydrate is a an antibacterial agent and prevents bacterial DNA replication by inhibiting DNA gyrase (topoisomerse) Target: DNA gyrase Pefloxacin is a synthetic chemotherapeutic agent used to treat severe and life-threatening bacterial infections.
  • HY-B1267S
    Sulfaguanidine-d4

    Bacterial Antibiotic Infection
    Sulfaguanidine-d4 is the deuterium labeled Sulfaguanidine. Sulfaguanidine, belongs to the class of sulfonamide drug, is an orally active antibiotic. Sulfaguanidine can be used for the research of enteric infections such as bacillary dysentery.
  • HY-139798
    Iboxamycin

    Bacterial Infection
    Iboxamycin is a potent antibiotic candidate bearing a fused bicyclic amino acid residue. Iboxamycin is orally bioavailable, safe and effective in treating both Gram-positive and Gram-negative bacterial infections in mice.
  • HY-B1190S
    Cefadroxil-d4 hydrate

    BL-S 578-d4 hydrate

    Bacterial Antibiotic Infection
    Cefadroxil-d4 (BL-S 578-d4) hydrate is the deuterium labeled Cefadroxil. Cefadroxil is a broad-spectrum antibiotic of the cephalosporin type, effective in Gram-positive and Gram-negative bacterial infections.
  • HY-W012531
    2-Hydroxycinnamic acid

    HIV SARS-CoV Infection
    2-Hydroxycinnamic acid is isolated from the methanol extract of Cinnamomum cassia. 2-Hydroxycinnamic acid shows inhibitory effects on infection of HIV/SARS-CoV S pseudovirus with an IC50 of 0.3 mM
  • HY-107902
    RIG-1 modulator 1

    HBV HCV HIV Influenza Virus Infection
    RIG-1 modulator 1 is an anti-viral compound which can be useful for the treatment of viral infections including influenza virus, HBV, HCV and HIV extracted from patent WO 2015172099 A1.
  • HY-136303
    GS-704277

    Drug Metabolite Infection
    GS-704277 is an alanine metabolite of Remdesivir. Remdesivir, a nucleoside analogue with effective antiviral activity, is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro.
  • HY-13231
    CDK9-IN-1

    CDK HIV Infection
    CDK9-IN-1 is a novel, selective CDK9 inhibitor for the treatment of HIV infection, with an IC50 of 39 nM for CDK9/CycT1, extracted from reference, compound 87.
  • HY-108009
    Rezafungin

    Biafungin; CD101; SP-3025

    Fungal Infection
    Rezafungin (Biafungin) is a next-generation, broad-spectrum, and long-lasting echinocandin. Rezafungin shows potent antifungal activity against Candida spp., Aspergillus spp., and Pneumocystis spp..
  • HY-108009A
    Rezafungin acetate

    Biafungin acetate; CD101 acetate; SP-3025 acetate

    Fungal Infection
    Rezafungin acetate (Biafungin acetate) is a next-generation, broad-spectrum, and long-lasting echinocandin. Rezafungin acetate shows potent antifungal activity against Candida spp., Aspergillus spp., and Pneumocystis spp..
  • HY-B0177
    Tinidazole

    Bacterial Infection
    Tinidazole, an orally available antibacterial agent, is a 5-nitroimidazole with selective activity against anaerobic bacteria and protozoa.
  • HY-145055
    HBV-IN-11

    HBV Infection
    HBV-IN-11 is a potent HBsAg secretion inhibitor with an EC50 of 0.46 µM (From patent WO2018085619A1, example 28).
  • HY-138094
    N-(2-Hydroxyethyl)oxamic acid

    Drug Metabolite Infection
    N-(2-hydroxyethyl)-oxamic acid is formed when Metronidazole is reduced either chemically or by the action of the intestinal bacteria. Metronidazole, a nitroimidazole antibiotic, has activity against various protozoans and most Gram-negative and Gram-positive anaerobic bacteria.
  • HY-111532
    (3R,4R)-A2-32-01

    Bacterial Infection
    (3R,4R)-A2-32-01 (compound 24(R,R)), the (R,R)-enantiomer of A2-32-01, is a Staphylococcus aureus caseinolytic protease (SaClpP) inhibitor.
  • HY-138061
    DENV-IN-2

    DNA/RNA Synthesis Infection
    DENV-IN-2 is a potent dengue viral replication inhibitor extracted from patent WO2018215315A1, compound 6AB, has an EC50 of 0.016 nM. DENV-IN-2 shows high potent activity against all four serotypes of the Dengue virus with EC50s ranging from 0.013 to 0.029 nM.
  • HY-P1783A
    M2e, human TFA

    Influenza Virus Infection
    M2e, human TFA, consisting of the 23 extracellular residues of M2 (the third integral membrane protein of influenza A), has been remarkably conserved in all human influenza A. M2e, human TFA is a valid and versatile vaccine candidate to protect against any strain of human influenza A.
  • HY-P1783
    M2e, human

    Influenza Virus Infection
    M2e, human, consisting of the 23 extracellular residues of M2 (the third integral membrane protein of influenza A), has been remarkably conserved in all human influenza A, which is a valid and versatile vaccine candidate to protect against any strain of human influenza A.
  • HY-124498
    Oxantel

    CP-14445

    nAChR Parasite Infection
    Oxantel (CP-14445), a m-oxyphenol derivative of Pyrantel (HY-12641), is a N-subtype AChR agonist. Oxantel is an anthelmintic, with excellent trichuricidal properties.
  • HY-136205
    IA-Alkyne

    Iodoacetamide-alkyne; N-Hex-5-ynyl-2-iodo-acetamide

    TRP Channel Infection Inflammation/Immunology
    IA-Alkyne (Iodoacetamide-alkyne; N-Hex-5-ynyl-2-iodo-acetamide) is a TRP channel (TRPC) agonist and has the potential for the study of respiratory infection. IA-Alkyne can be used to develop an isotopically tagged probe for quantitative cysteine-reactivity profiling.
  • HY-W013266S
    N4-Acetylsulfamethoxazole-d4

    Acetylsulfamethoxazole-d4

    Bacterial Infection Metabolic Disease
    N4-Acetylsulfamethoxazole-d4 (Acetylsulfamethoxazole-d4) is the deuterium labeled N4-Acetylsulfamethoxazole. N4-Acetylsulfamethoxazole (Acetylsulfamethoxazole) is a metabolite of Sulfamethoxazole (HY-B0322). Sulfamethoxazole is a sulfonamide bacteriostatic antibiotic, used for bacterial infections.
  • HY-N6711
    Equisetin

    HIV Integrase Infection
    Equisetin is an N-methylserine-derived acyl tetramic acid isolated from a terrestrial fungus Fusarium equiseti NRRL 5537. Equisetin is a tetramate-containing natural product with antibiotic and cytotoxic activity. Equisetin inhibits the growth of Gram-positive bacteria and HIV-1 integrase activity but shows no activity against Gram-negative bacteria. Equisetin is a Quorum-sensing inhibitor (QSI) that attenuates QS-regulated virulence phenotypes in P. aeruginosa without affecting the growth of bacterias, serves as a leading compound for the treatment of P. aeruginosa infections.
  • HY-W002198
    2-Hydroxyacetophenone

    HIV SARS-CoV Infection
    2-Hydroxyacetophenone is a principal root volatile of the Carissa edulis. 2-Hydroxyacetophenone shows inhibitory effects on infection of HIV/SARS-CoV S pseudovirus with an IC50 of 1.8 mM.
  • HY-B0439S1
    Sulfadoxine D3

    Sulphadoxine D3

    Parasite HIV Antibiotic Infection
    Sulfadoxine D3 is a deuterium labeled Sulfadoxine. Sulfadoxine is a long acting sulfonamide that is used, usually in combination with other drugs, for respiratory, urinary tract and malarial infections. Sulfadoxine inhibits HIV replication in peripheral blood mononuclear cells.
  • HY-N3515
    Multicaulisin

    Bacterial Infection
    Multicaulisin, a new Diels-Alder type adduct from Morus multicaulis roots, potently effects against Staphylococcus aureus (MRSA) isolates. Multicaulisin is an antibacterial drug and has the potential for MRSA infections research.
  • HY-18062S
    Pyrimethamine-d3

    Antifolate Parasite Infection
    Pyrimethamine-d3 (Pirimecidan-d3) is the deuterium labeled Pyrimethamine. Pyrimethamine is a medication used for protozoal infections; interferes with tetrahydrofolic acid synthesis from folic acid by inhibiting the enzyme dihydrofolate reductase (DHFR).
  • HY-B1267S1
    Sulfaguanidine-13C6

    Bacterial Antibiotic Infection
    Sulfaguanidine-13C6 is the 13C6 labeled Sulfaguanidine. Sulfaguanidine is an orally active antimicrobial agent/antibiotic of sulfonamide class. Sulfaguanidine can be used for the research of enteric infections such as bacillary dysentery.
  • HY-B1148AS2
    Furaltadone-d8

    Bacterial Infection
    Furaltadone-d8 (Altafur-d8) is the deuterium labeled Furaltadone. Furaltadone, a nitrofuran drug, has the potential for the study in infections of chickens with salmonella enteritidis. Furaltadone is inhibitory and bactericidal in vitro for staphylococci .
  • HY-120097
    R-10015

    LIM Kinase (LIMK) Reverse Transcriptase Infection
    R-10015, a broad-spectrum antiviral compound for HIV infection, acts as a potent and selective inhibitor of LIM domain kinase (LIMK) and binds to the ATP-binding pocket, with an IC50 of 38 nM for human LIMK1.
  • HY-B0293A
    Butoconazole

    Fungal Infection
    Butoconazole, an imidazole antifungal agent, is active against Candida spp. and effective against vaginal infections due to Candida albicans. Butoconazole is presumed to function as other imidazole derivatives via inhibition of steroid synthesis.
  • HY-106541
    Neticonazole

    Fungal Cancer Infection
    Neticonazole is an imidazole derivative and a potent and long-acting antifungal agent. Neticonazole has anti-infection and anti-cancer effects.
  • HY-14603
    Clioquinol

    Iodochlorhydroxyquin

    Fungal Autophagy Mitophagy Antibiotic Infection Cancer
    Clioquinol (Iodochlorhydroxyquin) is a topical antifungal agent with anticancer activity. Clioquinol acts as an oral antimicrobial agent for the research of diarrhea and skin infections. Antibiotic.
  • HY-128365
    Neticonazole hydrochloride

    Fungal Cancer Infection
    Neticonazole hydrochloride is an imidazole derivative and a potent and long-acting antifungal agent. Neticonazole hydrochloride has anti-infection and anti-cancer effects.
  • HY-108402
    Cefodizime

    Bacterial Antibiotic Infection
    Cefodizime is a third generation cephalosporin antibiotic with a broad spectrum of antibacterial activity. Cefodizime has no renal toxic effect, good tolerance and immune regulation activity, and has the potential for severe infections of the respiratory and urinary tracts.
  • HY-146345
    Antiviral agent 18

    Others Infection
    Antiviral agent 18 (Compound 5) is an anti-infection agent. Antiviral agent 18 results in good antiviral activity against murine norovirus. Antiviral agent 18 has the potential for the research of infectious and malignant diseases.
  • HY-B0035
    Sulfamethazine

    Sulfadimidine; Sulfadimerazine

    Bacterial Antibiotic Infection
    Sulfamethazine (Sulfadimidine) is an antimicrobial that is widely used to treat and prevent various animal diseases (such as gastrointestinal and respiratory tract infections). In China and the European Commission, the maximum residue level for Sulfamethazine in animal product is set at 100 µg/kg.
  • HY-B0035A
    Sulfamethazine sodium

    Sulfadimidine sodium; Sulfadimerazine sodium

    Bacterial Antibiotic Infection
    Sulfamethazine sodium (Sulfadimidine sodium) is an antimicrobial that is widely used to treat and prevent various animal diseases (such as gastrointestinal and respiratory tract infections). In China and the European Commission, the maximum residue level for Sulfamethazine sodium in animal product is set at 100 µg/kg.
  • HY-147531
    Antibacterial agent 106

    Bacterial Infection
    Antibacterial agent 106 (compound 8) is an orally active and potent antibacterial agent with antibiofilm activity. Antibacterial agent 106 shows potent antibacterial effect against multi-drug resistant (MDR)-Gram positive pathogens. Antibacterial agent 106 is highly effective in clearing 99.7% of the intracellular methicillin-resistant S. aureus (MRSA) harbored inside macrophages.
  • HY-124237A
    N-Octanoyl-L-homoserine lactone

    Bacterial Infection
    N-octanoyl-L-Homoserine lactone is a small diffusible signaling molecule involved in quorum sensing, thereby controlling gene expression and affecting cellular metabolism. N-octanoyl-L-Homoserine lactone can be used for the infection prevention and regulation of virulence in cystic fibro.
  • HY-108402A
    Cefodizime sodium

    Bacterial Antibiotic Infection
    Cefodizime sodium is a third generation cephalosporin antibiotic with a broad spectrum of antibacterial activity. Cefodizime sodium has no renal toxic effect, good tolerance and immune regulation activity, and can be used for the research of severe infections of the respiratory and urinary tracts.
  • HY-B0751
    Fumagillin

    Amebacilin; NSC9168

    Parasite HIV Antibiotic Infection
    Fumagillin(NSC9168) is an antimicrobial compound first isolated in 1949 from the fungus Aspergillus fumigatu. Fumagillin can inhibits HIV‐1 infection through the inhibition of HIV-1 viral protein R (Vpr) activity.
  • HY-19378
    MIV-150

    PC 815

    HIV Infection
    MIV-150 is a nonnucleoside reverse transcriptase (NNRT) inhibitor, blocking HIV-1 and HIV-2 infections, with an EC50<1 nM against HIV-1/HIV-2MN.
  • HY-146381
    SARS-CoV-2-IN-20

    SARS-CoV Infection
    SARS-CoV-2-IN-20 (Compound 1a) is a potent inhibitor of SARS-CoV-2 with an EC50 of 6.5 μM. SARS-CoV-2-IN-20 has the potential for the research of infection diseases.
  • HY-B0126
    Marbofloxacin

    Bacterial Antibiotic Infection
    Marbofloxacin is a third generation fluoroquinolone and orally active antimicrobial agent, which has a broad spectrum bactericidal activity and good efficacy. Marbofloxacin can be used for the research of infections by Gram-positive and Gram-negative bacteria and Mycoplasma.
  • HY-136597
    Remdesivir O-desphosphate acetonide impurity

    DNA/RNA Synthesis SARS-CoV Infection
    Remdesivir O-desphosphate acetonide impurity is an impurity of Remdesivir. Remdesivir (GS-5734), a nucleoside analogue with effective antiviral activity and is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro.
  • HY-B0126A
    Marbofloxacin hydrochloride

    Bacterial Antibiotic Infection
    Marbofloxacin hydrochloride is a third generation fluoroquinolone and orally active antimicrobial agent, which has a broad spectrum bactericidal activity and good efficacy. Marbofloxacin hydrochloride can be used for the research of infections by Gram-positive and Gram-negative bacteria and Mycoplasma.
  • HY-124042
    K6PC-5

    SphK Infection Neurological Disease
    K6PC-5, a synthetic ceramide derivative,is a direct sphingosine kinase 1(SPHK1) activator and elicites a rapid transient increase in intracellular calcium levels. K6PC-5 is used for the researches of skin diseases involving abnormal keratinocyte, neurodegeneration and virus infection.
  • HY-W040073
    Nifurtimox

    Parasite Lactate Dehydrogenase Cancer Infection
    Nifurtimox, an antiprotozoal agent, which is generally used for the treatment of infections with Trypanosoma cruzi, has been used in the therapy of neuroblastoma. Nifurtimox affects enzyme activity of lactate dehydrogenase (LDH).
  • HY-17591S
    Penicillin G-d5 potassium

    Benzylpenicillin-d5 potassium

    Bacterial Antibiotic Infection
    Penicillin G-d5 (Benzylpenicillin-d5) potassium is the deuterium labeled Penicillin G potassium. Penicillin G potassium is a fast-acting antibiotic; used to treat bacterial infections that affect the blood, heart, lungs, joints, and genital areas.
  • HY-B0293
    Butoconazole nitrate

    RS 35887

    Fungal Infection
    Butoconazole nitrate (RS 35887), an imidazole antifungal agent, is active against Candida spp. and effective against vaginal infections due to Candida albicans. Butoconazole nitrate is presumed to function as other imidazole derivatives via inhibition of steroid synthesis.
  • HY-144798
    FWM-5

    SARS-CoV Infection
    FWM-5 is a potent NSP13 helicase inhibitor. SARS-COV-2 NSP13 helicase enzyme plays crucial role in the virus life cycle. FWM-5 has the potential for the research of infection diseases.
  • HY-B0213S1
    Sulfameter-13C6

    Sulfametoxydiazine-13C6; 5-Methoxysulfadiazine-13C6

    Antibiotic Bacterial Infection
    Sulfameter-13C6 is the 13C6 labeled Sulfameter. Sulfameter (Sulfametoxydiazine; 5-Methoxysulfadiazine) is an effective long-acting sulfonamide antibiotic with antibacterial activities. Sulfameter can be used for the research of urinary tract infections and lepriasis.
  • HY-17413S
    Zidovudine-d3

    Azidothymidine-d3; AZT-d3; ZDV-d3

    HIV CRISPR/Cas9 Infection
    Zidovudine-d3 (Azidothymidine-d3) is the deuterium labeled Zidovudine. Zidovudine is a nucleoside reverse transcriptase inhibitor (NRTI), widely used to treat HIV infection. Zidovudine increases CRISPR/Cas9-mediated editing frequency.
  • HY-145119AS
    VV116

    JT001; GS-621763-d1 hydrobromide

    SARS-CoV RSV Influenza Virus Infection
    VV116 (JT001) is an orally active nucleoside antiviral agent against SARS-CoV-2 and respiratory syncytial virus (RSV) infection. VV116 has favorable oral bioavailability, excellent in vitro antiviral activity and selectivity.
  • HY-15781
    Morinidazole

    Bacterial Infection
    Morinidazole is an orally active and 5-nitroimidazole antimicrobial agent that undergoes extensive metabolism in humans via N +-glucuronidation and sulfation. Morinidazole can be used for bacterial infections research including appendicitis and pelvic inflammatory disease (PID) caused by anaerobic bacteria.
  • HY-136149A
    Mpro inhibitor N3 hemihydrate

    SARS-CoV Virus Protease Infection
    Mpro inhibitor N3 hemihydrate is a potent inhibitor of SARS-CoV-2 Mpro with an EC50 of 16.77 μM for SARS-CoV-2. Mpro inhibitor N3 hemihydrate specifically inhibits Mpro from multiple coronaviruses, including SARS-CoV and MERS-CoV. Mpro inhibitor N3 hemihydrate displays inhibition against HCoV-229E, FIPV, and MHV-A59 with individual IC50 of 4.0 μM, 8.8 μM, and 2.7 μM, respectively.
  • HY-150625
    SARS-CoV-2 nsp13-IN-4

    SARS-CoV Infection
    SARS-CoV-2 nsp13-IN-4 (C4 (d)) is a potent and selective nsp13 helicase small-molecule inhibitor and inhibit the ssDNA+ ATPase activity of nsp13 with an IC50 value of 57 μM. SARS-CoV-2 nsp13-IN-4 is druglike molecule with molecular weight of less than 450Da and can provide a broad-spectrum antiviral effect.
  • HY-107566
    Conessine

    Histamine Receptor Parasite Infection
    Conessine, a steroidal alkaloid, is a potent and selective histamine H3 receptor antagonist with Kis of 5.4, 6.0, 5.7 and 25 nM for human, dog, guinea pig, and rat H H3 receptor, respectively. Anti-malarial activity.
  • HY-146330
    FtsZ-IN-2

    Bacterial Infection
    FtsZ-IN-2 (Compound 19) is an inhibitor of the bacterial cell division protein FtsZ with GTPase inhibitory activity. FtsZ-IN-2 exhibits anti-staphylococcal activity with MIC values of 2 µg/ml for MSSA and MRSA.
  • HY-13234
    Rifaximin

    Bacterial Antibiotic DNA/RNA Synthesis Infection
    Rifaximin, a gastrointestinal-selective antibiotic, binds the β-subunit of bacterial DNA-dependent RNA polymerase, resulting in inhibition of bacterial RNA synthesis. Rifaximin susceptibility is higher against Gram-positive strains (MIC: 0.03-5 mg/ml) compared to Gram-negative bacteria (MIC: 8-50 mg/mL).
  • HY-14588
    Lopinavir

    ABT-378

    HIV HIV Protease SARS-CoV Infection
    Lopinavir (ABT-378) is a highly potent, selective peptidomimetic inhibitor of the HIV-1 protease, with Kis of 1.3 to 3.6 pM for wild-type and mutant HIV protease. Lopinavir acts by arresting maturation of HIV-1 thereby blocking its infectivity. Lopinavir is also a SARS-CoV 3CL pro inhibitor with an IC50 of 14.2 μM.
  • HY-17413S1
    Zidovudine-13C,d3

    Azidothymidine-13C,d3; AZT-13C,d3; ZDV-13C,d3

    HIV CRISPR/Cas9 Infection
    Zidovudine-13C,d3 is the 13C- and deuterium labeled Zidovudine. Zidovudine is a nucleoside reverse transcriptase inhibitor (NRTI), widely used to treat HIV infection. Zidovudine increases CRISPR/Cas9-mediated editing frequency.
  • HY-10394
    Linezolid

    PNU-100766

    Bacterial Antibiotic Infection
    Linezolid (PNU-100766) is the first member of the class of oxazolidinone synthetic antibiotic. Linezolid acts by inhibiting the initiation of bacterial protein synthesis. Linezolid is used for the treatment of serious infections caused by Gram-positive bacteria that are resistant to several other antibiotics.
  • HY-B0439S
    Sulfadoxine-d4

    Sulphadoxine-d4

    Parasite HIV Antibiotic Endogenous Metabolite Infection
    Sulfadoxine-d4 (Sulphadoxine-d4) is the deuterium labeled Sulfadoxine. Sulfadoxine(Sulphadoxine) is a long acting sulfonamide that is used, usually in combination with other drugs, for respiratory, urinary tract and malarial infections. Sulfadoxine inhibits HIV replication in peripheral blood mononuclear cells.
  • HY-116229
    Gemifloxacin

    SB-265805; LB20304

    Antibiotic Bacterial Infection
    Gemifloxacin, a fluoroquinolone, is a potent and orally active antipneumococcal agent. Gemifloxacin shows bactericidal activity against highly quinolone-resistant pneumococci.Gemifloxacin can be used for the research of respiratory infections, such as community-acquired pneumonia (CAP) and acute exacerbation of chronic bronchitis (AECB).
  • HY-148104
    ACSS2-IN-2

    Others Cancer Infection Metabolic Disease Inflammation/Immunology Neurological Disease
    ACSS2-IN-2 is an acyl-CoA synthetase short-chain family member 2 (ACSS2) inhibitor. ACSS2-IN-2 can inhibit ACSS2 activity with an IC50 value of 3.8 nM. ACSS2-IN-2 can be used for the research of several diseases, such as viral infection, metabolic disorders, neuropsychiatric diseases, inflammatory/autoimmune conditions and cancer.
  • HY-17362
    Vancomycin hydrochloride

    Bacterial Autophagy Antibiotic Infection Cancer
    Vancomycin hydrochloride is an antibiotic for the treatment of bacterial infections. It acts by inhibiting the second stage of cell wall synthesis of susceptible bacteria. Vancomycin also alters the permeability of the cell membrane and selectively inhibits ribonucleic acid synthesis.
  • HY-130997
    17-GMB-APA-GA

    HSP ADC Cytotoxin Cancer Infection
    17-GMB-APA-GA is an ADC Cytotoxin. 17-GMB-APA-GA is a potent HSP90 inhibitor and used for latent T. gondii infection research.
  • HY-P1222
    LL-37, human

    Bacterial Infection
    LL-37, human is a 37-residue, amphipathic, cathelicidin-derived antimicrobial peptide, which exhibits a broad spectrum of antimicrobial activity. LL-37, human could help protect the cornea from infection and modulates wound healing.
  • HY-B1370A
    (S)-Hydroxychloroquine

    (S)-HCQ

    Parasite Toll-like Receptor (TLR) SARS-CoV Autophagy Infection
    (S)-Hydroxychloroquine ((S)-HCQ) is the enantiomer of Hydroxychloroquine. Hydroxychloroquine, a synthetic antimalarial drug, inhibits Toll-like receptor 7/9 (TLR7/9) signaling, and shows efficiently inhibits SARS-CoV-2 infection in vitro.
  • HY-N0091S1
    Hypoxanthine-13C,15N2

    Purin-6-o-13C,15N2l; Sarcine-13C,15N2

    Bacterial Infection
    Hypoxanthine-13C,15N2 is a 15N-labeled and 13C-labled Furaltadone. Furaltadone, a nitrofuran drug, has the potential for the study in infections of chickens with salmonella enteritidis. Furaltadone is inhibitory and bactericidal in vitro for staphylococci
  • HY-115440
    CRS3123 dihydrochloride

    REP-3123 dihydrochloride

    Bacterial Antibiotic Infection
    CRS3123 (REP-3123) dihydrochloride, a fully synthetic antibacterial agent, potently inhibits methionyl-tRNA synthetase (MetRS) of Clostridioides difficile, inhibiting Clostridioides difficile toxin production and spore formation. CRS3123 dihydrochloride is an oral agent for the research of Clostridioides difficile infection (CDI).
  • HY-P2124
    Cyclo(L-Trp-L-Trp)

    Antibiotic Bacterial Infection
    Cyclo(L-Trp-L-Trp) is an antibiotic, and shows antimicrobial activity. Cyclo(L-Trp-L-Trp) can inhibit A. baumannii, as well as Candida albicans, Bacillus subtilis, Micrococcus luteus, Saccharomyces cerevisiae, Aspergillus niger, Staphylococcus aureus. Cyclo(L-Trp-L-Trp) can be used in microbial infection research.
  • HY-B1370B
    (R)-Hydroxychloroquine

    (R)-HCQ

    Parasite Toll-like Receptor (TLR) SARS-CoV Autophagy Infection
    (R)-Hydroxychloroquine is the enantiomer of Hydroxychloroquine. Hydroxychloroquine is a synthetic antimalarial drug which can also inhibit Toll-like receptor 7/9 (TLR7/9) signaling. Hydroxychloroquine is efficiently inhibits SARS-CoV-2 infection in vitro.
  • HY-146373
    Antibacterial agent 95

    Bacterial Infection
    The minimum inhibitory concentration (MIC) of a new 2- (quinoline-4-methoxy) acetamide antituberculotic agent against the reference strain of Mycobacterium tuberculosis H37Rv was as low as 0.3 μ M. It also inhibited the growth of Mycobacterium tuberculosis in the macrophage model of tuberculosis infection.
  • HY-103583
    KDU731

    PI4K Parasite Infection
    KDU731, an orally active C. parvum PI4K inhibitor with an IC50 value of 25 nM, blocks Cryptosporidium infection in vitro and in vivo. KDU731 is a promising drug candidate for the treatment of diarrhea caused by Cryptosporidium and meets a broad range of safety.
  • HY-15781A
    Morinidazole (R enantiomer)

    R-Morinidazole

    Bacterial Infection
    Morinidazole R enantiomer (R-Morinidazole) is an orally active and 5-nitroimidazole antimicrobial agent that undergoes extensive metabolism in humans via N +-glucuronidation and sulfation. Morinidazole R enantiomer can be used for bacterial infections research including appendicitis and pelvic inflammatory disease (PID) caused by anaerobic bacteria.
  • HY-N7121
    Erythromycin estolate

    Bacterial Infection
    Erythromycin estolate, erythromycin derivative, is a macrolide antibiotic used in the treatment of a wide variety of bacterial infections. Erythromycin estolate causes several cases of liver injury which mostly include cholestatic hepatitis. Erythromycin estolate toxicity is related to its inhibitory effect on bile acid transport.
  • HY-107212
    Selamectin

    Parasite Chloride Channel P-glycoprotein Infection
    Selamectin, a semi-synthetic macrocyclic lactone, is a potent parasiticide and anthelminthic. Selamectin activates glutamate-gated chloride channels in neurons and pharyngeal muscles to prevent heartworm, Lymphatic filariae, and nematode infection. Selamectin is also a potent P-glycoprotein substrate and a P-glycoprotein inhibitor with an IC50 of 120 nM.
  • HY-B0024
    Prulifloxacin

    NM441

    Bacterial Antibiotic Infection
    Prulifloxacin (NM441) is an orally active fluoroquinolone antibiotic with a broad spectrum of activity against Gram-positive and -negative bacteria. Prulifloxacin is a prodrug of a thiazeto-quinoline carboxylic acid derivative Ulifloxacin (NM394). Prulifloxacin has the potential for lower urinary tract infections and exacerbations of chronic bronchitis.
  • HY-P1222A
    LL-37, human TFA

    Bacterial Infection
    LL-37, human TFA is a 37-residue, amphipathic, cathelicidin-derived antimicrobial peptide, which exhibits a broad spectrum of antimicrobial activity. LL-37, human TFA could help protect the cornea from infection and modulates wound healing.
  • HY-B0126S
    Marbofloxacin-d8

    Bacterial Antibiotic Infection
    Marbofloxacin-d8 is the deuterium labeled Marbofloxacin. Marbofloxacin is a third generation fluoroquinolone and orally active antimicrobial agent, which has a broad spectrum bactericidal activity and good efficacy. Marbofloxacin can be used for the research of infections by Gram-positive and Gram-negative bacteria and Mycoplasma.
  • HY-W015591
    Mandelic acid

    (±)-Mandelic acid; DL-Mandelic acid

    Bacterial Endogenous Metabolite Infection
    Mandelic acid ((±)-Mandelic acid), an alpha-hydroxycarboxylic acid, has been widely used as an intermediate of pharmaceutical and fine chemicals. Mandelic acid shows antimicrobial activity and has been used for the research of urinary tract infections and vaginal trichomoniasis. Mandelic acid exhibits high sperm-immobilizing activity and low vaginal irritation.
  • HY-17430
    Amprenavir

    VX-478

    HIV HIV Protease SARS-CoV Infection Cancer
    Amprenavir (VX-478) is a HIV protease inhibitor (Ki=0.6 nM) used to treat HIV infection. Amprenavir is also a SARS-CoV 3CL pro inhibitor with an IC50 of 1.09 μM.
  • HY-N10197
    Pulixin

    Parasite Endogenous Metabolite Infection
    Pulixin prevents FREP1 from binding to P. falciparum-infected cell lysate. Pulixin blocks the transmission of the parasite to mosquitoes with an EC50 of 11 µM. Pulixin also inhibits the proliferation of asexual-stage P. falciparum with an EC50 of 47 nM.
  • HY-N7701A
    L-Triguluronic acid

    Fungal Infection
    L-Triguluronic acid is a linear polysaccharide copolymer composed of three L-guluronic acid (G) and can be used to from Alginate. Alginate is a generic name of unbranched polyanionic polysaccharides and can be used for the research of anti-fungal agents delivery carries.
  • HY-139982
    OX11

    Bacterial Infection
    OX11 is a selective inhibitor of S. pneumoniae, P. aeruginosa, and E. coli bacterial strains.
  • HY-16776
    Censavudine

    OBP-601; BMS-986001

    HIV Reverse Transcriptase Nucleoside Antimetabolite/Analog Infection
    Censavudine (OBP-601; BMS-986001), a nucleoside analog, is a nucleoside reverse transcriptase inhibitor. Censavudine is a potent HIV inhibitor with EC50 ranges from 30 nM to 81 nM and 450 nM to 890 nM for HIV-2 and HIV-1, respectively.
  • HY-146331
    PC190723

    Bacterial Antibiotic Infection
    PC190723 (Compound 2) is an inhibitor of the bacterial cell division protein FtsZ with an IC50 of 55 ng/ml. FtsZ-IN-3 exhibits anti-staphylococcal activity with MIC values of 1 µg/ml for MSSA and MRSA.
  • HY-136259
    ML188

    SARS-CoV Virus Protease Infection
    ML188, a first in class probe, is a selective non-covalent SARS-CoV 3CLpro inhibitor with an IC50 of 1.5 μM. Antiviral activity.
  • HY-N7701C
    L-Pentaguluronic acid

    Others Infection
    L-Pentaguluronic acid is a linear polysaccharide copolymer composed of four L-guluronic acid (G).
  • HY-N7701
    L-Diguluronic acid

    Fungal Infection
    L-Diguluronic acid is a linear polysaccharide copolymer composed of two L-guluronic acid (G) and can be used to from Alginate. Alginate is a generic name of unbranched polyanionic polysaccharides and can be used for the research of antifungal agents delivery carries.
  • HY-B0319
    Tioconazole

    UK-20349

    Fungal Antibiotic Infection
    Tioconazole (UK-20349) is an antifungal imidazole derivative with broad spectrum activity. Tioconazole has inhibitory active aginst several dermatophytes and several yeasts with MIC50s <3.12 mg/L and <9 mg/L, respectively.
  • HY-151442
    Antifungal agent 43

    Fungal Infection
    Antifungal agent 43 (compound B05) is an antifungal agent. Antifungal agents 43 has antifungal activity by inhibiting biofilm formation. Antifungal agent 43 has low toxicity in human cancer cell lines.
  • HY-N7701D
    L-Hexaguluronic acid

    Others Infection
    L-Hexaguluronic acid is a linear polysaccharide copolymer composed of six L-guluronic acid (G).
  • HY-151440
    Antifungal agent 42

    Fungal Infection
    Antifungal agent 42 is an antifungal agent. Antifungal agent 42 has an inhibitory effect on lanosterol 14α-demethylase (CYP51) of C.alb.. Antifungal agent 42 inhibits biofilm formation.
  • HY-132987
    ARX-1796

    AV-006

    Bacterial Infection
    ARX-1796 (AV-006), an Avibactam prodrug, is an orally bioavailable β-lactamase inhibitor. Avibactam has a spectrum of inhibition of class A and C β-lactamases, including ESBLs, AmpC and Klebsiella pneumoniae carbapenemase (KPC) enzymes.
  • HY-B0806
    Proguanil

    Parasite Antifolate Infection
    Proguanil, an antimalarial prodrug, is metabolized to the active metabolite Cycloguanil (HY-12784). Proguanil is a dihydrofolate reductase (DHFR) inhibitor.
  • HY-N2562
    Norwogonin

    5,7,8-Trihydroxyflavone

    Enterovirus Infection
    Norwogonin, isolated from Scutellaria baicalensis Georgi, possesses antiviral activity against Enterovirus 71 (EV71) with an IC50 of 31.83 μg/ml
  • HY-N7701B
    L-Tetraguluronic acid

    Others Infection
    L-Tetraguluronic acid is a linear polysaccharide copolymer composed of four L-guluronic acid (G).
  • HY-B0806A
    Proguanil hydrochloride

    Parasite Antifolate Infection
    Proguanil hydrochloride, an antimalarial prodrug, is metabolized to the active metabolite Cycloguanil (HY-12784). Proguanil hydrochloride is a dihydrofolate reductase (DHFR) inhibitor.
  • HY-138247
    β-Lactamase-IN-2

    EX-A4764; UUN51204

    Bacterial Antibiotic Infection
    β-Lactamase-IN-2 is a beta-lactamase inhibitor, extracted from patent WO 2019075084 A1, compound 1. β-Lactamase-IN-2 has anti-microbial and anti-bacterial effects.
  • HY-W009168
    Tazobactam sodium

    Bacterial Antibiotic Infection
    Tazobactam sodium is an antibiotic of the beta-lactamase inhibitor class. Ceftolozane combines with Tazobactam, extends the activity of ceftolozane against many ESBL-producing Enterobacteriaceae and some Bacteroides spp..
  • HY-151437
    Antifungal agent 40

    Fungal Infection
    Antifungal agent 40 is an antifungal agent which extends into the narrow hydrophobic pocket II of C.alb. CYP51. Antifungal agent 40 has an inhibitory effect on lanosterol 14α-demethylase (CYP51). Antifungal agent 40 inhibits biofilm formation.
  • HY-147014
    Cyclic HPMPC

    CMV Orthopoxvirus Infection
    Cyclic HPMPC is a potent antiviral agent. Cyclic HPMPC can increase arterial oxygen saturation levels in lethal vaccinia virus (IHD strain)-infected mice. Cyclic HPMPC improves the outcome of congenital guinea pig cytomegalovirus (GPCMV) infection and decreases viral replication in guinea pig model.
  • HY-B0510S
    Trimethoprim-d9

    Antifolate Bacterial Antibiotic Infection
    Trimethoprim-d9 is the deuterium labeled Trimethoprim. Trimethoprim is a bacteriostatic antibiotic and an orally active dihydrofolate reductase inhibitor. Trimethoprim is active against a wide range of Gram-positive and Gram-negative aerobic bacteria. Trimethoprim has the potential for urinary tract infections, Shigellosis and Pneumocystis pneumonia treatment.
  • HY-137958A
    Bemnifosbuvir

    AT-511

    HCV SARS-CoV Infection
    Bemnifosbuvir (AT-511) is a potent and orally active HCV viral replication inhibitor. Bemnifosbuvir is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC90=0.47 μM). Bemnifosbuvir has pangenotypic antiviral activity.
  • HY-B0510S2
    Trimethoprim-d3

    Antifolate Bacterial Antibiotic Infection
    Trimethoprim-D3 is the deuterium labeled Trimethoprim. Trimethoprim is a bacteriostatic antibiotic and an orally active dihydrofolate reductase inhibitor. Trimethoprim is active against a wide range of Gram-positive and Gram-negative aerobic bacteria. Trimethoprim has the potential for urinary tract infections, Shigellosis and Pneumocystis pneumonia treatment.
  • HY-90001S
    Ritonavir-d6

    HIV Protease HIV SARS-CoV Apoptosis Infection
    Ritonavir-d6 (ABT 538-d6) is the deuterium labeled Ritonavir. Ritonavir (ABT 538) is an inhibitor of HIV protease used to treat HIV infection and AIDS. Ritonavir is also a SARS-CoV 3CL pro inhibitor with an IC50 of 1.61 μM.
  • HY-18980
    Rottlerin

    Mallotoxin; NSC 56346; NSC 94525

    PKC Autophagy Apoptosis HIV Infection Cancer
    Rottlerin, a natural product purified from Mallotus Philippinensis, is a specific PKC inhibitor, with IC50 values for PKCδ of 3-6 μM, PKCα,β,γ of 30-42 μM, PKCε,η,ζ of 80-100 μM. Rottlerin acts as a direct mitochondrial uncoupler, and stimulates autophagy by targeting a signaling cascade upstream of mTORC1. Rottlerin induces apoptosis via caspase 3 activation. Rottlerin inhibits HIV-1 integration and Rabies virus (RABV) infection.
  • HY-N6647
    Luteolin-7-rutinoside

    Others Infection Inflammation/Immunology
    Luteolin-7-rutinoside has both anti-arthritic and antifungal activities, can result in a combination therapy for the treatment of fungal arthritis due to C. albicans infection.
  • HY-B1148B
    Furaltadone L-tartrate

    Altafur L-tartrate

    Bacterial Infection Inflammation/Immunology
    Furaltadone L-tartrate (Altafur L-tartrate), a nitrofuran drug, has the potential for the study in infections of chickens with salmonella enteritidis. Furaltadone is inhibitory and bactericidal in vitro for staphylococci .
  • HY-17427S
    Emtricitabine-15N,D2

    BW1592-15N,D2

    HIV Reverse Transcriptase Endogenous Metabolite Infection
    Emtricitabine-15N,D2 (BW1592-15N,D2) is a 15N-labeled and deuterium labeled Emtricitabine. Emtricitabine is a nucleoside reverse transcriptase inhibitor (NRTI) with an EC50 of 0.01 µM in PBMC cell. It is an antiviral drug for the treatment of HIV infection.
  • HY-B0957S
    Erythromycin ethylsuccinate-13C,d3

    Erythromycin ethyl succinate-13C,d3; EES-13C,d3

    Bacterial HIV Autophagy Antibiotic Infection
    Erythromycin ethylsuccinate-13C,d3 is the 13C- and deuterium labeled Erythromycin Ethylsuccinate. Erythromycin Ethylsuccinate is an antibiotic useful for the treatment of a number of bacterial infections, has an antimicrobial spectrum similar to or slightly wider than that of penicillin. Erythromycin Ethylsuccinate has antiviral activity against HIV-1.
  • HY-17580
    Fidaxomicin

    OPT-80; PAR-101

    DNA/RNA Synthesis Bacterial Apoptosis Antibiotic Infection
    Fidaxomicin (OPT-80), a macrocyclic antibiotic, is an orally active and potent RNA polymerase inhibitor. Fidaxomicin has a narrow spectrum of antibacterial activity and a good anti-Clostridium difficile activity (MIC90=0.12 μg/mL). Fidaxomicin can be used for Clostridium difficile infection (CDI) research.
  • HY-B0488
    Clorsulon

    L631529; MK401

    Parasite Infection
    Clorsulon (L631529; MK401) is an orally active flukicidal agent against liver flukes (Fasciola hepatica and Fasciola gigantica) infections in calves and sheep. Clorsulon is also a competitive inhibitor of both 3-phosphoglycorate and ATP andinhibits glucose utilization and acetate and propionate formation by mature Fasciola hepatica in vitro.
  • HY-13859
    Clevudine

    L-FMAU

    HBV DNA/RNA Synthesis Orthopoxvirus Infection
    Clevudine (L-FMAU), a nucleoside analog of the unnatural L-configuration, has potent anti-HBV activity with long half-life, low toxicity. Clevudine is a non-competitive inhibitor that is not incorporated into the viral DNA but rather binds to the polymerase. Clevudine is active against cowpox virus respiratory infection in mice.
  • HY-146116
    Antifungal agent 32

    Fungal Infection
    Antifungal agent 32 (compound 1a) is a potent antifungal agent. Antifungal agent 32 inhibits Candida albicans filamentation and biofilm formation. Antifungal agent 32 inhibits the morphological switching of Candida albicans and its adherence to epithelial cells. Antifungal agent 32 can be used for Candida albicans infections research.
  • HY-N2036
    Mosloflavone

    Enterovirus Bacterial Infection
    Mosloflavone is a flavonoid isolated from Scutellaria baicalensis Georgi with  anti-EV71 activity. Mosloflavone  inhibits VP2 virus replication and protein expression during the initial stage of virus infection and inhibits viral VP2 capsid protein synthesis. Mosloflavone is a promising biocide and inhibits P. aeruginosa virulence and biofilm formation.
  • HY-142932
    BTK-IN-6

    Btk Cancer Inflammation/Immunology Neurological Disease
    BTK-IN-6 is a potent inhibitor of Bruton's Tyrosine Kinase (BTK). BTK is a member of the Tec family of tyrosine kinases and plays an important role in the regulation of early B-cell development and mature B-cell activation and survival. BTK-IN-6 has the potential for the research of immune disorders, cancer, cardiovascular diseases, viral infections, inflammation, metabolism/endocrine function disorders, and neurological disorders (extracted from patent WO2021136219A1, compound 8).
  • HY-107193
    Bacitracin

    Bacterial Antibiotic Infection Cancer
    Bacitracin is a polypeptide antibiotic used for staphylococcal infections. Bacitracin functions as an inhibitor of cell wall biosynthesis through its binding to the undecaprenyl pyrophosphate. The combination of bacitracin with other antibiotics has been efficient to be used as a topical agent.
  • HY-W040073S
    Nifurtimox-d4

    Parasite Lactate Dehydrogenase Cancer Infection
    Nifurtimox-d4 is deuterium labeled Nifurtimox. Nifurtimox, an antiprotozoal agent, which is generally used for the treatment of infections with Trypanosoma cruzi, has been used in the therapy of neuroblastoma. Nifurtimox affects enzyme activity of lactate dehydrogenase (LDH).
  • HY-146344
    Antiviral agent 17

    Others Infection
    Antiviral agent 17 (Compound 4) is an anti-infection agent. Antiviral agent 17 retains its antiviral effect in a human replicon assay (EC50 = 0.015 μM). Antiviral agent 17 results in good antiviral activity against murine norovirus. Antiviral agent 17 has the potential for the research of infectious and malignant diseases.
  • HY-15592S
    Cabotegravir-d3

    GSK-1265744-d3; S/GSK1265744-d3

    HIV HIV Integrase Infection
    Cabotegravir-d3 (GSK-1265744-d3) is the deuterium labeled Cabotegravir. Cabotegravir is a potent HIV integrase inhibitor as an oral lead-in tablet and long-acting injectable for the treatment and prevention of HIV infection. Cabotegravir is an inhibitor of OAT1 (IC50 0.81 μM) and OAT3 (IC50 0.41 μM).
  • HY-124801
    ABMA

    Bacterial Influenza Virus Parasite Infection
    ABMA is a broad-spectrum inhibitor of intracellular toxins and pathogens. ABMA efficiently protects cells against various toxins and pathogens including viruses, intracellular bacteria and parasite. ABMA selectively acts at host cell late endosomes rather than targeting toxin or pathogen itself. ABMA has broad-spectrum anti-infection activity.
  • HY-15872A
    FTI-277 hydrochloride

    Farnesyl Transferase Apoptosis Ras Cancer Infection
    FTI-277 hydrochloride is an inhibitor of farnesyl transferase (FTase); a highly potent Ras CAAX peptidomimetic which antagonizes both H- and K-Ras oncogenic signaling. FTI-277 hydrochloride can inhibit hepatitis delta virus (HDV) infection.
  • HY-15872
    FTI-277

    Farnesyl Transferase Apoptosis Ras Cancer Infection
    FTI-277 is an inhibitor of farnesyl transferase (FTase); a highly potent Ras CAAX peptidomimetic which antagonizes both H- and K-Ras oncogenic signaling. FTI-277 can inhibit hepatitis delta virus (HDV) infection.
  • HY-143288
    NTPDase-IN-2

    Phosphatase Cancer Infection Inflammation/Immunology
    NTPDase-IN-2 (compound 5g) is a selective NTPDase inhibitor with IC50s of 0.04 and 2.27 µM for h-NTPDase-2/-8, respectively. NTPDase-IN-2 non-competitively inhibits h-NTPDase-1/-2 with a Km of 74 µM for h-NTPDase-2. NTPDase-IN-2 can be used in studies of cancer, immunologic disorders as well as bacterial infections.
  • HY-P1258A
    PSI TFA

    Proteasome Inhibitor 1 TFA

    Proteasome Cancer Infection
    PSI (TFA) is a potent proteasome inhibitor. PSI (TFA) inhibits the proliferation of primary effusion lymphoma (PEL) cells. PSI (TFA) can be used for the research of Kaposi’s sarcoma-associated herpesvirus (KSHV) infection and KSHV-associated lymphomas.
  • HY-P1258
    PSI

    Proteasome Inhibitor 1

    Proteasome Cancer Infection
    PSI (Proteasome Inhibitor 1) is a potent proteasome inhibitor. PSI inhibits the proliferation of primary effusion lymphoma (PEL) cells. PSI has the potential for the research of Kaposi’s sarcoma-associated herpesvirus (KSHV) infection and KSHV-associated lymphomas.
  • HY-W031727
    Hydroxychloroquine

    Parasite Toll-like Receptor (TLR) SARS-CoV Autophagy Cancer Infection
    Hydroxychloroquine is a synthetic antimalarial agent which can also inhibit Toll-like receptor 7/9 (TLR7/9) signaling. Hydroxychloroquine is efficiently inhibits SARS-CoV-2 infection in vitro.
  • HY-13672
    LY2334737

    Nucleoside Antimetabolite/Analog Enterovirus Cancer Infection
    LY2334737 is an nucleoside analog and is an orally active prodrug of Gemcitabine. LY2334737 exhibits inhibitory activity against enterovirus A71 (EV-A71) infection. LY2334737 has antiviral and anticancer effects.
  • HY-144066
    Cap-dependent endonuclease-IN-21

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-21 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-21 inhibits the replication of influenza virus. ap-dependent endonuclease-IN-21 has the potential for the research of influenza virus infection (influenza A) (extracted from patent WO2021233302A1, compound 8B or 8A).
  • HY-B1002S
    Oxolinic acid-d5

    Bacterial Antibiotic DNA/RNA Synthesis Infection
    Oxolinic acid-d5 is the deuterium labeled Oxolinic acid. Oxolinic acid is an antibiotic against both Gram-negative and Gram-positive bacteria. Oxolinic acid can be used for the research of acute and chronic urinary tract infections. Oxolinic acid is a DNA/RNA synthesis inhibitor. Oxolinic acid acts a dopamine uptake inhibitor and stimulants locomotor effect in mice.
  • HY-90001S1
    Ritonavir-13C,d3

    ABT 538-13C,d3; RTV-13C,d3

    HIV Protease HIV SARS-CoV Apoptosis Infection
    Ritonavir-13C,d3 (ABT 538-13C,d3) is the 13C- and deuterium labeled Ritonavir. Ritonavir (ABT 538) is an inhibitor of HIV protease used to treat HIV infection and AIDS. Ritonavir is also a SARS-CoV 3CL pro inhibitor with an IC50 of 1.61 μM.
  • HY-15303B
    Pritelivir mesylate hydrate

    AIC316 mesylate hydrate; BAY 57-1293 mesylate hydrate

    HSV Infection
    Pritelivir mesylate hydrate (BAY 57-1293 mesylate hydrate), an inhibitor of the viral helicase-primase complex, exhibits antiviral activity in vitro and in animal models of herpes simplex virus (HSV) infection. Pritelivir mesylate hydrate is active against herpes simplex virus types 1 and 2 (HSV-1 and HSV-2) with the IC50 of 0.02 μM against HSV1-2.
  • HY-13801
    Fexinidazole

    HOE 239

    Parasite Infection
    Fexinidazole (HOE 239) is an orally active, potent nitroimidazole antitrypanosomal drug. Fexinidazole shows trypanocidal activity against T. brucei subspecies and strains with IC50s of 0.7-3.3 μM (0.2-0.9 μg/ml). Fexinidazol has the potential for human sleeping sickness (HAT) caused by infection with T. brucei.
  • HY-15303
    Pritelivir

    AIC316; BAY 57-1293

    HSV Infection
    Pritelivir (AIC316), an inhibitor of the viral helicase-primase complex, exhibits antiviral activity in vitro and in animal models of herpes simplex virus (HSV) infection. Pritelivir is active against herpes simplex virus types 1 and 2 (HSV-1 and HSV-2) with the IC50 of 0.02 μM against HSV1-2.
  • HY-144067
    Cap-dependent endonuclease-IN-23

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-23 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-23 inhibits the replication of influenza virus. ap-dependent endonuclease-IN-23 has the potential for the research of influenza virus infection (influenza A) (extracted from patent WO2021233302A1, compound 8A or 8B).
  • HY-15303A
    Pritelivir mesylate

    AIC316 mesylate; BAY 57-1293 mesylate

    HSV Infection
    Pritelivir mesylate (BAY 57-1293 mesylate), an inhibitor of the viral helicase-primase complex, exhibits antiviral activity in vitro and in animal models of herpes simplex virus (HSV) infection. Pritelivir mesylate is active against herpes simplex virus types 1 and 2 (HSV-1 and HSV-2) with the IC50 of 0.02 μM against HSV1-2.
  • HY-143287
    NTPDase-IN-1

    Phosphatase Cancer Infection Inflammation/Immunology
    NTPDase-IN-1 (compound 5a) is a selective NTPDase inhibitor with IC50s of 0.05, 0.23 and 0.54 µM for h-NTPDase-1/-2/-8, respectively. NTPDase-IN-1 non-competitively inhibits h-NTPDase-1/-2 with a Km of 21 µM for h-NTPDase-1. NTPDase-IN-1 can be used in studies of cancer, immunologic disorders as well as bacterial infections.
  • HY-145439
    Colistin adjuvant-1

    Bacterial NF-κB Infection
    Colistin adjuvant-1 is a colistin adjuvant, shows increased colistin potentiation activity against Gram-negative bacteria. Colistin adjuvant-1 inhibits NF-κB with an IC50 of 0.209 μM.
  • HY-19509
    IQP-0528

    Reverse Transcriptase HIV Infection
    IQP-0528 is a highly potent nonnucleoside reverse transcriptase inhibitor (NNRTI). IQP-0528 shows nanomolar activity against both HIV-1 and HIV-2, with an HIV-1 EC50 of 0.2 nM and an HIV-2 EC50 of 100 nM.
  • HY-145440
    Colistin adjuvant-2

    Bacterial Infection
    Colistin adjuvant-2 is a colistin adjuvant, shows increased colistin potentiation activity against Gram-negative bacteria.
  • HY-117684
    DDD107498

    DDD-498; M5717

    Parasite CaMK Infection
    DDD107498 (DDD-498) is a potent and orally active antimalarial agent, inhibits multiple life-cycle stages of the parasite, with an EC50 of 1 nM against P. falciparum 3D7. DDD107498 inhibits protein synthesis by targeting eEF2/CaMKIII, with an EC50 of 2 nM for WT-PfeEF2.
  • HY-148077
    Phosphoglycolohydroxamic acid

    Bacterial Fungal Infection
    Phosphoglycolohydroxamic acid is a potent aldolase and triose-phosphate isomerase inhibitor. Phosphoglycolohydroxamic acid can be used in the research of antibacterial and antifungal area.
  • HY-18649
    Galidesivir hydrochloride

    BCX4430 hydrochloride; Immucillin-A hydrochloride

    DNA/RNA Synthesis SARS-CoV Filovirus Infection
    Galidesivir (BCX4430) hydrochloride, an adenosine analog and a direct-acting antiviral agent, disrupts viral RNA-dependent RNA polymerase (RdRp) activity. Galidesivir hydrochloride is active in vitro against many RNA viral pathogens, including the filoviruses and emerging infectious agents such as MERS-CoV, SARS-CoV, and SARS-CoV-2. Galidesivir hydrochloride inhibits some negative-sense RNA viruses with EC50s ranging from ~3 to ~68 μM.
  • HY-100373
    Isavuconazonium sulfate

    BAL8557-002

    Fungal Infection
    Isavuconazonium sulfate (BAL8557-002), the prodrug of the active triazole Isavuconazole, is an orally active antifungal agent. Isavuconazonium sulfate is used for invasive aspergillosis and mucormycosis.
  • HY-145053
    HBV-IN-10

    HBV Infection
    HBV-IN-10 is an enantiomer of compound 6 (WO2021204258A1). Compound 6 is a hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC50 ≤0.05 μM). From patent WO2021204258A1, compound 6.
  • HY-145060
    HBV-IN-13

    HBV Infection
    HBV-IN-12 is a potent hepatitis B surface antigen (HBsAg) inhibitor. From patent WO2021204252A1, compound 1_B.
  • HY-117684A
    DDD107498 succinate

    DDD-498 succinate

    Parasite CaMK Infection
    DDD107498 succinate (DDD-498 succinate) is a potent and orally active antimalarial agent, inhibits multiple life-cycle stages of the parasite, with an EC50 of 1 nM against P. falciparum 3D7. DDD107498 succinate inhibits protein synthesis by targeting eEF2/CaMKIII, with an EC50 of 2 nM for WT-PfeEF2.
  • HY-145059
    HBV-IN-12

    HBV Infection
    HBV-IN-12 is a potent hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC50 ≤0.05 μM). HBV-IN-12 shows anti-HBV DNA activity (0.001 μM<EC50 ≤0.02 μM). From patent WO2021204252A1, compound 15.
  • HY-18649A
    Galidesivir

    BCX4430; Immucillin-A

    DNA/RNA Synthesis SARS-CoV Filovirus Infection
    Galidesivir (BCX4430), an adenosine analog and a direct-acting antiviral agent, disrupts viral RNA-dependent RNA polymerase (RdRp) activity. Galidesivir is active in vitro against many RNA viral pathogens, including the filoviruses and emerging infectious agents such as MERS-CoV, SARS-CoV, and SARS-CoV-2. Galidesivir inhibits some negative-sense RNA viruses with EC50s ranging from ~3 to ~68 μM.
  • HY-126085
    (±)-Alliin

    (±)-L-Alliin

    SARS-CoV Infection
    (±)-Alliin is the main active component of garlic. (±)-Alliin is a putative inhibitor of the main protease of SARS-CoV-2 (Mpro).
  • HY-117766
    PC945

    Fungal Cytochrome P450 Infection
    PC945, a potent, long-acting antifungal triazole, possesses activity against a broad range of both azole-susceptible and azole-resistant strains of Aspergillus fumigatus. PC945 is also a potent, tightly binding inhibitor of A. fumigatus sterol 14α-demethylase activity, CYP51A and CYP51B, with IC50s of 0.23 μM and 0.22 μM, respectively.
  • HY-145053A
    (5S,8R)-HBV-IN-10

    HBV Infection
    (5S,8R)-HBV-IN-10 is an enantiomer of compound 6 (WO2021204258A1). Compound 6 is a hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC50 ≤0.05 μM). From patent WO2021204258A1, compound 6.
  • HY-147255
    Canocapavir

    ZM-H1505R

    HBV Infection
    Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B. .
  • HY-136425
    Fosetyl-aluminum

    Fosetyl-Al

    Fungal Infection
    Fosetyl-aluminum (Fosetyl-Al) is an active ingredient in many fungicides against downy mildew. Fosetyl-aluminum is used to control many diseases caused by Phytophthora spp. on agricultural and horticultural crops.
  • HY-125713
    Ganoderic acid Y

    Glucosidase Enterovirus Infection
    Ganoderic acid Y is a α-glucosidase inhibitor with an IC50 of 170 μM for yeast α-glucosidase. Ganoderic acid Y inhibits enterovirus 71 (EV71) replication through blocking EV71 uncoating.
  • HY-128780B
    SPR206 acetate

    Bacterial Antibiotic Infection
    SPR206 acetate is a polymyxin analog with antibiotic activity against Gram-negative pathogens, including multidrug-resistant (MDR) variants. SPR206 acetate has an anti-bacterial infection effect by interacting with the bacterium’s outer membrane. The MIC values of SPR206 acetate against Pseudomonas aeruginosa Pa14 and Acinetobacter baumannii NCTC13301 are both 0.125 mg/L.
  • HY-B0413S
    Fenbendazole-d3

    Parasite HIF/HIF Prolyl-Hydroxylase Antibiotic Infection
    Fenbendazole-d3 is a deuterium labeled Fenbendazole. Fenbendazole is a benzimidazole anthelmintic. Fenbendazole is active against Giardia in vitro (IC50 = 0.3 μM). Fenbendazole (20 mg/kg) prevents infiltration of parasites into the brain in a rabbit model of E. cuniculi infection. Fenbendazole also activates HIF-1α and prevents oxidative stress-induced death in primary neurons in vitro.
  • HY-B0293S
    Butoconazole-d5 nitrate

    RS 35887-d5

    Fungal Infection
    Butoconazole-d5 nitrate (RS 35887-d5) is the deuterium labeled Butoconazole nitrate. Butoconazole nitrate (RS 35887), an imidazole antifungal agent, is active against Candida spp. and effective against vaginal infections due to Candida albicans. Butoconazole nitrate is presumed to function as other imidazole derivatives via inhibition of steroid synthesis.
  • HY-10367A
    Canertinib dihydrochloride

    CI-1033 dihydrochloride; PD-183805 dihydrochloride

    EGFR Orthopoxvirus Cancer Infection
    Canertinib dihydrochloride (CI-1033 dihydrochloride) is a potent and irreversible EGFR inhibitor; inhibits cellular EGFR and ErbB2 autophosphorylation with IC50s of 7.4 and 9 nM. Canertinib dihydrochloride is active against vaccinia virus respiratory infection in mice.
  • HY-B0255
    Adefovir dipivoxil

    GS 0840

    HBV Reverse Transcriptase Endogenous Metabolite Infection Cancer
    Adefovir dipivoxil, an adenosine analogue, is an oral prodrug of the nucleoside reverse transcriptase inhibitor Adefovir. Adefovir dipivoxil inhibits both the wild type and HBV Lamivudine-resistant strains. Adefovir dipivoxil shows anti-orthopoxvirus activity.
  • HY-A0281S
    4-Phenylbutyric acid-d11

    4-PBA-d11; Benzenebutyric acid-d11

    HDAC Virus Protease Cancer Infection
    4-Phenylbutyric acid-d11 (4-PBA-d11) is the deuterium labeled 4-Phenylbutyric acid. 4-Phenylbutyric acid (4-PBA) is an inhibitor of HDAC and endoplasmic reticulum (ER) stress, used in cancer and infection research.
  • HY-17430S1
    Amprenavir-d4-1

    VX-478-d4-1

    HIV HIV Protease SARS-CoV Infection Cancer
    Amprenavir-d4-1 is deuterium labeled Amprenavir. Amprenavir (VX-478) is a HIV protease inhibitor (Ki=0.6 nM) used to treat HIV infection. Amprenavir is also a SARS-CoV 3CLpro inhibitor with an IC50 of 1.09 μM.
  • HY-B0307A
    Idoxuridine hydrate

    5-Iodo-2′-deoxyuridine hydrate; 5-IUdR hydrate; IdUrd hydrate

    Phosphatase Infection
    Idoxuridine (5-Iodo-2′-deoxyuridine, 5-IUdR, IdUrd) hydrate is an iodinated thymidine analogue that competitively inhibits phosphorylases. Idoxuridine can inhibit viral activity, particularly viral eye infections, including herpes simplex keratitis, by inhibiting DNA polymerase and affecting viral replication. Idoxuridine against feline herpesvirus has the IC50 value of 4.3 μM.
  • HY-B0693A
    Ranitidine bismuth citrate

    Histamine Receptor Bacterial SARS-CoV Infection
    Ranitidine bismuth citrate is an orally active Histamine H2-receptor antagonist with an IC50 of 3.3 μM. Ranitidine bismuth citrate has high selectivity for SARS-CoV-2-infected cells. Ranitidine bismuth citrate is a commonly used agent anti-Helicobacter pylori infection with an MIC90 value of 16 ng/L.
  • HY-145949
    Remdesivir de(ethylbutyl 2-aminopropanoate)

    Others Infection
    Remdesivir de(ethylbutyl 2-aminopropanoate) is an impurity of Remdesivir. Remdesivir, a nucleoside analogue with effective antiviral activity, has EC50s of 74 nM for SARS-CoV and MERS-CoV in HAE cells, and 30 nM for murine hepatitis virus in delayed brain tumor cells. Remdesivir is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro.
  • HY-N10177
    Peniterphenyl A

    HSV Infection
    Peniterphenyl A is a natural product obtained from a deep-sea-derived Penicillium sp. Peniterphenyl A inhibits HSV-1/2 virus entry into cells and may block HSV-1/2 infection through direct interaction with virus envelope glycoprotein D to interfere with virus adsorption and membrane fusion. Peniterphenyl A is a promising lead compound against HSV-1/2.
  • HY-16908A
    Lefamulin acetate

    BC-3781 acetate

    Bacterial Antibiotic Infection
    Lefamulin acetate (BC-3781 acetate) is an orally active antibiotic for community-acquired bacterial pneumonia (CABP) treatment. Lefamulin acetate (BC-3781 acetate) is the first semi-synthetic pleuromutilin for systemic treatment of bacterial infections in humans. Lefamulin acetate (BC-3781 acetate) inhibits protein synthesis by binding to the peptidyl transferase center of the 50S bacterial ribosome, preventing the binding of transfer RNA for peptide transfer.
  • HY-143750
    Cap-dependent endonuclease-IN-7

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-7 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-7 Inhibits the synthesis of viral mRNA and eventually inhibits virus proliferation. Cap-dependent endonuclease-IN-7 has the potential for the research of viral infections (including influenza A, influenza B and influenza C) (extracted from patent WO2020177715A1, compound 5)
  • HY-17395S
    Terbinafine-d3 hydrochloride

    TDT 067-d3 hydrochloride

    Fungal Bacterial Antibiotic Infection
    Terbinafine-d3 (TDT 067-d3) hydrochloride is the deuterium labeled Terbinafine hydrochloride. Terbinafine hydrochloride (TDT 067 hydrochloride) is an antifungal medication used to treat fungal infections. It is a potent non-competitive inhibitor of squalene epoxidase from Candida with a Ki of 30 nM. Terbinafine hydrochloride also antibacterial activity against certain Gram-positive and Gram-negative bacteria.
  • HY-P1649
    SPR741

    NAB741

    Bacterial Antibiotic Infection
    SPR741 (NAB741) is a cationic peptide derived from polymyxin B and is a potentiator molecule. SPR741 increases the permeability of the outer membrane of Gram-negative bacteria and is used to treat severe Gram-negative bacteria infections. SPR741 inhibits multidrug-resistant Gram-negative bacteria. The spectrum of activity of the antibiotic can be widened when used in combination with SPR741.
  • HY-17395AS
    Terbinafine-d7

    TDT 067-d7

    Fungal Bacterial Antibiotic Infection
    Terbinafine-d7 (TDT 067-d7) is the deuterium labeled Terbinafine. Terbinafine (TDT 067) is an antifungal medication used to treat fungal infections. It is a potent non-competitive inhibitor of squalene epoxidase from Candida with a Ki of 30 nM. Terbinafine also antibacterial activity against certain Gram-positive and Gram-negative bacteria.
  • HY-137958
    Bemnifosbuvir hemisulfate

    AT-527

    HCV SARS-CoV Infection
    Bemnifosbuvir hemisulfate (AT-527), a hemisulfate salt of AT-511, a guanosine nucleotide prodrug, is a potent and orally active HCV viral replication inhibitor. Bemnifosbuvir hemisulfate is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC90=0.47 μM). Bemnifosbuvir hemisulfate has pangenotypic antiviral activity.
  • HY-B1370
    Hydroxychloroquine sulfate

    HCQ sulfate

    Parasite Toll-like Receptor (TLR) SARS-CoV Autophagy Cancer Infection
    Hydroxychloroquine sulfate (HCQ sulfate) is a synthetic antimalarial agent which can also inhibit Toll-like receptor 7/9 (TLR7/9) signaling. Hydroxychloroquine sulfate is efficiently inhibits SARS-CoV-2 infection in vitro.
  • HY-B0024S
    Prulifloxacin-d8

    Bacterial Antibiotic Infection
    Prulifloxacin-d8 (NM441-d8) is the deuterium labeled Prulifloxacin. Prulifloxacin (NM441) is an orally active fluoroquinolone antibiotic with a broad spectrum of activity against Gram-positive and -negative bacteria. Prulifloxacin is a prodrug of a thiazeto-quinoline carboxylic acid derivative Ulifloxacin (NM394). Prulifloxacin has the potential for lower urinary tract infections and exacerbations of chronic bronchitis.
  • HY-B0441S
    Tobramycin-18O,d1

    Nebramycin Factor 6-18O,d1; Deoxykanamycin B-18O,d1

    Bacterial Antibiotic Infection
    Tobramycin-18O,d1 (Nebramycin Factor 6-18O,d1; Deoxykanamycin B-18O,d1) is the deuterium labeled Tobramycin. Tobramycin (Nebramycin Factor 6) is a parenterally administered, broad spectrum aminoglycoside antibiotic that is widely used in the treatment of moderate to severe bacterial infections due to sensitive organisms.
  • HY-108062A
    BLI-489 hydrate

    Bacterial Infection
    BLI-489 hydrate, a penem β-lactamase inhibitor, is active against class A and class C as well as some class D β-lactamases. The combination of Piperacillin and BLI-489 hydrate is efficacious against murine infections caused by class A (including extended-spectrum β-lactamases), class C (AmpC), and class D β-lactamase-expressing pathogens.
  • HY-104077S1
    Remdesivir-d4

    GS-5734-d4

    DNA/RNA Synthesis SARS-CoV Infection
    Remdesivir-d4 is deuterium labeled Remdesivir. Remdesivir (GS-5734), a nucleoside analogue with effective antiviral activity, has EC50s of 74 nM for SARS-CoV and MERS-CoV in HAE cells, and 30 nM for murine hepatitis virus in delayed brain tumor cells. Remdesivir is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro.
  • HY-123319A
    Antofloxacin

    Bacterial Infection
    Antofloxacin is a well tolerate, orally active and broad-spectrum 8-amino-fluoroquinolone with potent antibacterial activities. Antofloxacin shows superior antibacterial activity against gyrA mutation-positive H. pylori strains, especially in Asn87- mutated strains, compared to levofloxacin. Antofloxacin is a weak, reversible inhibitor of CYP1A2 for the treatment of infections caused by a diverse group of bacterial species.
  • HY-P1649B
    SPR741 acetate

    NAB741 acetate

    Bacterial Antibiotic Infection
    SPR741 acetate (NAB741 acetate) is a cationic peptide derived from polymyxin B and is a potentiator molecule. SPR741 acetate increases the permeability of the outer membrane of Gram-negative bacteria and is used to treat severe Gram-negative bacteria infections. SPR741 acetate inhibits multidrug-resistant Gram-negative bacteria. The spectrum of activity of the antibiotic can be widened when used in combination with SPR741 acetate.
  • HY-123319
    Antofloxacin hydrochloride

    Bacterial Infection
    Antofloxacin hydrochloride is a well tolerate, orally active and broad-spectrum 8-amino-fluoroquinolone with potent antibacterial activities. Antofloxacin hydrochloride shows superior antibacterial activity against gyrA mutation-positive H. pylori strains, especially in Asn87- mutated strains, compared to levofloxacin. Antofloxacin hydrochloride is a weak, reversible inhibitor of CYP1A2 for the treatment of infections caused by a diverse group of bacterial species.
  • HY-103697
    Gardiquimod

    Toll-like Receptor (TLR) HIV Cancer Infection
    Gardiquimod, an imidazoquinoline analog, is a TLR7/8 agonist. Gardiquimod could inhibit HIV-1 infection of macrophages and activated peripheral blood mononuclear cells (PBMCs). Gardiquimod specifically activates TLR7 when used at concentrations below 10 μM.
  • HY-122571
    Retro-2

    Filovirus Parasite Autophagy Cancer Infection
    Retro-2 is a selective inhibitor of retrograde protein trafficking at the endosome-trans-Golgi network interface. Retro-2 is an ebolavirus (EBOV) infection inhibitor with an EC50 of 12.2 µM in HeLa cells. Retro-2 induces cell autophagy.
  • HY-N1474
    Picfeltarraenin IA

    Cholinesterase (ChE) Cancer Infection Inflammation/Immunology
    Picfeltarraenin IA, a triterpenoid obtained from Picriafel-terrae Lour (P.fel-terrae), is an acetylcholinesterase (AChE) inhibitor. Picfeltarraenin IA can be used for the treatment of herpes infections, cancer and inflammation.
  • HY-N5076
    Picfeltarraenin IV

    Cholinesterase (ChE) Cancer Infection Inflammation/Immunology
    Picfeltarraenin IV, a triterpenoid obtained from Picriafel-terrae Lour (P.fel-terrae), is an acetylcholinesterase (AChE) inhibitor. Picfeltarraenin IV can be used for the treatment of herpes infections, cancer and inflammation.
  • HY-N2211
    Picfeltarraenin IB

    Cholinesterase (ChE) Cancer Infection Inflammation/Immunology
    Picfeltarraenin IB, a triterpenoid obtained from Picriafel-terrae Lour (P.fel-terrae), is an acetylcholinesterase (AChE) inhibitor. Picfeltarraenin IB can be used for the treatment of herpes infections, cancer and inflammation.
  • HY-145871
    BA38017

    HBV Infection
    BA38017 is a potent HBV core protein assembly modulator. BA38017 inhibits HBV replication with an EC50 of 0.20 μM.
  • HY-U00124
    Tromantadine

    HSV Infection
    Tromantadine hydrochloride, an Amantadine derivative with antiherpetic activity, inhibits herpes simplex virus type 1 (HSV-1) and HSV-2 replication.
  • HY-13998A
    Dasabuvir sodium

    ABT-333 sodium

    HCV DNA/RNA Synthesis Infection
    Dasabuvir (ABT-333) sodium is a nonnucleoside hepatitis C virus (HCV) polymerase inhibitor. Dasabuvir sodium inhibits RNA-dependent RNA polymerase encoded by the HCV NS5B gene. Dasabuvir sodium inhibits genotype 1a (strain H77) and 1b (strain Con1) replicons, with EC50 values of 7.7 and 1.8 nM, respectively.
  • HY-15899
    Des(benzylpyridyl) Atazanavir

    HIV Protease HIV Drug Metabolite Infection
    Des(benzylpyridyl) Atazanavir (compound M1) is a N-dealkylation product of Atazanavir (HY-17367) metabolite. Atazanavir is a highly selective HIV-1 protease inhibitor. Des(benzylpyridyl) Atazanavir may contribute to the effectiveness Atazanavir but also to the toxicity and interactions. Des(benzylpyridyl) Atazanavir can be used for further research of Atazanavir effects.
  • HY-135221
    Cefcapene pivoxil hydrochloride

    Bacterial Antibiotic Infection
    Cefcapene pivoxil hydrochloride, an antibiotic, is an orally active and potent 3rd-generation cephalosporin with a wide spectrum of anti-bacterial activity.Cefcapene pivoxil hydrochloride has the potential for the palmoplantar pustulosis (PPP) treatment.
  • HY-B1497
    Silver sulfadiazine

    AgSD

    Bacterial DNA/RNA Synthesis Antibiotic Infection
    Silver sulfadiazine (AgSD), a sulfonamide antibiotic, effects a dual inhibitory action on bacterial growth by its sulfa moiety (SD-SDZ) that prevents bacterial folate absorption and subsequent DNA synthesis. The silver that is released from Silver sulfadiazine binds and disrupts the DNA structure, precluding bacterial DNA replication.
  • HY-17395B
    Terbinafine lactate

    TDT 067 lactate

    Antibiotic Fungal Bacterial Infection
    Terbinafine lactate (TDT 067 lactate) is an orally active and potent antifungal agent. Terbinafine lactate is a potent non-competitive inhibitor of squalene epoxidase from Candida, with a Ki of 30 nM. Terbinafine lactate also shows antibacterial activity against certain Gram-positive and Gram-negative bacteria.
  • HY-13836
    ELQ-300

    Parasite Infection
    ELQ-300 is a potent and orally bioavailable antimalarial agent, acts as an inhibitor of the reductive (Qi) site of the cytochrome bc1 complex (cyt bc1). ELQ-300 inhibits growth of P. falciparum Dd2, Tm90-C2B, and D1 with IC50 values of 6.6, 4.6 and 160 nM, respectively. ELQ-300 can be used for the research of antimalarial.
  • HY-19936A
    ACHN-975 TFA

    Bacterial Infection
    ACHN-975 TFA is a selective LpxC inhibitor and exhibits a subnanomolar LpxC inhibitory activity. ACHN-975 TFA is against a wide range of gram-negative bacterias with low MIC values (≤1 μg/mL).
  • HY-17395
    Terbinafine hydrochloride

    TDT 067 hydrochloride

    Fungal Bacterial Antibiotic Infection
    Terbinafine hydrochloride (TDT 067 hydrochloride) is an orally active and potent antifungal agent. Terbinafine hydrochloride is a potent non-competitive inhibitor of squalene epoxidase from Candida, with a Ki of 30 nM. Terbinafine hydrochloride also shows antibacterial activity against certain Gram-positive and Gram-negative bacteria.
  • HY-D0976
    NF279

    P2X Receptor HIV Infection
    NF279 is a potent selective and reversible P2X1 receptor antagonist, with an IC50 of 19 nM. NF279 displays good selectivity over P2X2, P2X3 (IC50=1.62 μM), P2X4 (IC50>300 μM). NF279 is a dual HIV-1 coreceptor inhibitor that interferes with the functional engagement of CCR5 and CXCR4 by Env.
  • HY-17395A
    Terbinafine

    TDT 067

    Fungal Bacterial Antibiotic Infection
    Terbinafine (TDT 067) is an orally active and potent antifungal agent. Terbinafine is a potent non-competitive inhibitor of squalene epoxidase from Candida, with a Ki of 30 nM. Terbinafine also shows antibacterial activity against certain Gram-positive and Gram-negative bacteria.
  • HY-U00124B
    Tromantadine hydrochloride

    HSV Infection
    Tromantadine hydrochloride, an Amantadine derivative with antiherpetic activity, inhibits herpes simplex virus type 1 (HSV-1) and HSV-2 replication.
  • HY-13998
    Dasabuvir

    ABT-333

    HCV DNA/RNA Synthesis Infection
    Dasabuvir (ABT-333) is a nonnucleoside hepatitis C virus (HCV) polymerase inhibitor. Dasabuvir inhibits RNA-dependent RNA polymerase encoded by the HCV NS5B gene. Dasabuvir inhibits genotype 1a (strain H77) and 1b (strain Con1) replicons, with EC50 values of 7.7 and 1.8 nM, respectively.
  • HY-151151
    Trypanothione synthetase-IN-3

    Parasite Infection
    Trypanothione synthetase-IN-3 is a noncompetitive mixed hyperbolic Trypanothione synthetase (TryS) inhibitor (Ki: 0.8 μM). Trypanothione synthetase-IN-3 can be used in the study of parasites, such as L. infantum.
  • HY-136267
    HCV-IN-30

    HCV Infection
    HCV-IN-30 (compound 48) is a HCV NS5A replication complex inhibitor, with IC50s of 901 and 102 nM for genotypes 1a and 1b replicons, respectively.
  • HY-10367
    Canertinib

    CI-1033; PD-183805

    EGFR Orthopoxvirus Cancer Infection
    Canertinib (CI-1033;PD-183805) is a potent and irreversible EGFR inhibitor; inhibits cellular EGFR and ErbB2 autophosphorylation with IC50s of 7.4 and 9 nM. Canertinib is active against vaccinia virus respiratory infection in mice.
  • HY-17430S
    Amprenavir-d4

    HIV HIV Protease SARS-CoV Infection Cancer
    Amprenavir-d4 is the deuterium labeled Amprenavir. Amprenavir (VX-478) is a HIV protease inhibitor (Ki=0.6 nM) used to treat HIV infection. Amprenavir is also a SARS-CoV 3CL pro inhibitor with an IC50 of 1.09 μM.
  • HY-B0977
    Dicloxacillin Sodium hydrate

    Dicloxacillin sodium salt monohydrate

    Bacterial Antibiotic Infection Inflammation/Immunology
    Dicloxacillin Sodium hydrate (Dicloxacillin sodium salt monohydrate) is a narrow-spectrum β-Lactam antibiotic of the penicillin class, is used to treat infections caused by susceptible Gram-positive bacteria, active against beta-lactamase-producing organisms such as Staphylococcus aureus.
  • HY-104077S2
    Remdesivir impurity 9-d4

    DNA/RNA Synthesis SARS-CoV Infection
    Remdesivir impurity 9-d4 is deuterium labeled Remdesivir. Remdesivir (GS-5734), a nucleoside analogue with effective antiviral activity, has EC50s of 74 nM for SARS-CoV and MERS-CoV in HAE cells, and 30 nM for murine hepatitis virus in delayed brain tumor cells. Remdesivir is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro.
  • HY-P1649A
    SPR741 TFA

    NAB741 TFA

    Bacterial Antibiotic Infection
    SPR741 TFA (NAB741 TFA) is a cationic peptide derived from polymyxin B and is a potentiator molecule. SPR741 TFA increases the permeability of the outer membrane of Gram-negative bacteria and is used to treat severe Gram-negative bacteria infections. SPR741 TFA inhibits multidrug-resistant Gram-negative bacteria. The spectrum of activity of the antibiotic can be widened when used in combination with SPR741 TFA.
  • HY-147979
    CXCR4 antagonist 9

    CXCR Cancer Infection
    CXCR4 antagonist 9 (Compound 2) is a CXCR4 antagonist with an IC50 of 15 nM. CXCR4 antagonist 9 inhibits CXCL12 induced cytosolic calcium increase with an IC50 of 1.3 nM.
  • HY-147978
    CXCR4 antagonist 8

    CXCR Cancer Infection
    CXCR4 antagonist 8 (Compound 3) is a CXCR4 antagonist with an IC50 of 57 nM. CXCR4 antagonist 8 inhibits CXCL12 induced cytosolic calcium increase with an IC50 of 0.24 nM. CXCR4 antagonist 8 inhibits CXLC12/CXCR4 mediated cell migration.
  • HY-103697A
    Gardiquimod diTFA

    Toll-like Receptor (TLR) HIV Cancer Infection
    Gardiquimod diTFA, an imidazoquinoline analog, is a TLR7/8 agonist. Gardiquimod diTFA could inhibit HIV-1 infection of macrophages and activated peripheral blood mononuclear cells (PBMCs). Gardiquimod diTFA specifically activates TLR7 when used at concentrations below 10 μM.
  • HY-B0425A
    Novobiocin sodium

    Albamycin sodium; Cathomycin sodium

    Bacterial Antibiotic Orthopoxvirus Apoptosis DNA/RNA Synthesis HSP Infection Cancer
    Novobiocin (Albamycin) sodium is a potent and orally active antibiotic. Novobiocin sodium also is a DNA gyrase inhibitor and a heat shock protein 90 (Hsp90) antagonist. Novobiocin sodium has the potential for the research of highly beta-lactam-resistant pneumococcal infections. Novobiocin sodium shows anti-orthopoxvirus activity.
  • HY-19727
    FOY 251 free base

    Ser/Thr Protease SARS-CoV Infection Metabolic Disease
    FOY 251 free base, an anti-proteolytic active metabolite of Camostate (HY-13512), acts as a proteinase inhibitor. FOY 25 free base inhibits SARS-CoV-2 infection in cells assay.
  • HY-N0677B
    Dehydroandrographolide succinate potassium sodium salt

    Others Infection Inflammation/Immunology
    Dehydroandrographolide succinate (potassium sodium salt), extracted from herbal medicine Andrographis paniculata (Burm f) Nees, is widely used for the treatment of viral pneumonia and viral upper respiratory tract infections because of its immunostimulatory, anti-infective and anti-inflammatory effect.
  • HY-B1159S
    Nitroxoline-D4

    8-Hydroxy-5-nitroquinoline-D4; 5-Nitro-8-quinolinol-D4

    Bacterial Autophagy Antibiotic Infection Cancer
    Nitroxoline-D4 (8-Hydroxy-5-nitroquinoline-D4) is the deuterium labeled Nitroxoline. Nitroxoline is an antibiotic that has proven to be very effective at combating biofilm infections. Nitroxoline functions by chelating Fe2+ and Zn2+ ions from the biofilm matrix.
  • HY-W031727S
    Hydroxychloroquine-d4-1 sulfate

    Parasite Toll-like Receptor (TLR) SARS-CoV Autophagy Cancer Infection
    Hydroxychloroquine-d4-1 sulfate is the deuterium labeled Hydroxychloroquine. Hydroxychloroquine is a synthetic antimalarial agent which can also inhibit Toll-like receptor 7/9 (TLR7/9) signaling. Hydroxychloroquine is efficiently inhibits SARS-CoV-2 infection in vitro.
  • HY-B1150
    Clofoctol

    Bacterial SARS-CoV Antibiotic Cancer Infection
    Clofoctol is a bacteriostatic antibiotic. Clofoctol is used in the treatment of respiratory tract and ear, nose and throat infections caused by Gram-positive bacteria. Clofoctol is only functional against Gram-positive bacteria and can penetrate into human lung tissue. Clofoctol is also an inhibitor of prostate cancer. Clofoctol has antiviral potency.
  • HY-B0425
    Novobiocin

    Albamycin; Cathomycin

    Antibiotic DNA/RNA Synthesis HSP Apoptosis Bacterial Orthopoxvirus Cancer Infection
    Novobiocin (Albamycin) is a potent and orally active antibiotic. Novobiocin also is a DNA gyrase inhibitor and a heat shock protein 90 (Hsp90) antagonist. Novobiocin has the potential for the research of highly beta-lactam-resistant pneumococcal infections. Novobiocin shows anti-orthopoxvirus activity.
  • HY-15287S
    Nelfinavir-d3

    HIV Protease HIV Infection Cancer
    Nelfinavir-d3 (AG1341-d3) is the deuterium labeled Nelfinavir. Nelfinavir (AG-1341) is a potent and orally bioavailable HIV-1 protease inhibitor (Ki=2 nM) for HIV infection. Nelfinavir is a broad-spectrum, anticancer agent.
  • HY-N0081
    (±)-Praeruptorin A

    Calcium Channel Infection
    (±)-Praeruptorin A is the di-esterified product of cis-khellactone (CKL) and the major active ingredient in Peucedani Radix which consists of the dried roots of Peucedanum praeruptorumDunn (Apiaceae). (±)-Praeruptorin A has been widely employed as one of the famous traditional Chinese medicines (TCMs) for the treatment of cough with thick sputum and dyspnea, nonproductive cough and upper respiratory infections for centuries in China. (±)-Praeruptorin A has dramatically therapeutic effects on hypertension mainly through acting as a Ca 2+-influx blocker.
  • HY-143744
    Cap-dependent endonuclease-IN-3

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-3 is a potent inhibitor of cap-dependent endonuclease (CEN). Not only can Cap-dependent endonuclease-IN-3 inhibit influenza virus well, but also has lower cytotoxicity, better in vivo agent kinetic properties and in vivo pharmacodynamic properties. Cap-dependent endonuclease-IN-3 has the potential for the research of influenza A and influenza B infection (extracted from patent WO2019141179A1, compound VI-1).
  • HY-139597
    Temocillin disodium

    BRL 17421 disodium

    Bacterial Infection Inflammation/Immunology
    Temocillin disodium, a 6-α-methoxy penicillin, possesses antibacterial activity.
  • HY-137522
    Zidovudine O-β-D-glucuronide sodium

    3'-Azido-3'-deoxythymidine β-D-glucuronide sodium

    Drug Metabolite Others
    Zidovudine O-β-D-glucuronide (3'-Azido-3'-deoxythymidine β-D-glucuronide) sodium is the major metabolite of Zidovudine. Zidovudine is a nucleoside reverse transcriptase inhibitor (NRTI), widely used to treat HIV infection.
  • HY-145052
    HBV-IN-9

    HBV Infection
    HBV-IN-9 is a potent HBsAg (HBV Surface antigen) inhibitor (IC50=10 nM) and HBV DNA production inhibitor (IC50=0.15 nM in HepG2.2.15 cells). From patent WO2018001952A1, example 20.
  • HY-136071
    QPX7728 methoxy acetoxy methy ester

    Bacterial Infection
    QPX7728 methoxy acetoxy methy ester is a boronic acid β-lactamase inhibitor, exacted from WO2018005662A1, compound 43.
  • HY-147314
    HIV-IN-6

    HIV Src Infection
    HIV-IN-6 is a HIV-Ⅰ viral replication inhibitor by targeting Src family kinases (SFK) that interact with Nef protein of the virus, such as Hck.
  • HY-136070
    QPX7728 bis-acetoxy methyl ester

    Bacterial Infection
    QPX7728 bis-acetoxy methyl ester is a boronic acid β-lactamase inhibitor, exacted from WO2018005662A1, compound 42.
  • HY-144280
    MsbA-IN-2

    Bacterial Infection
    MsbA-IN-2 (compound 12) is a potent lipopolysaccharide transporter MsbA inhibitor with an IC50 of 2 nM for E. coli MsbA.
  • HY-117318
    PDE12-IN-1

    Phosphodiesterase (PDE) Infection
    PDE12-IN-1 is a potent and selective PDE12 inhibitor with a pIC50 value for enzyme inhibition of 9.1. PDE12-IN-1 increases 2′,5′-linked adenylate polymers (2-5A) levels, and the pEC50 value is 7.7. PDE12-IN-1 shows antiviral activity.
  • HY-19915
    Contezolid

    MRX-I

    Bacterial Antibiotic Monoamine Oxidase Infection Inflammation/Immunology
    Contezolid (MRX-I), a new and orally active oxazolidinone, is an antibiotic in study for complicated skin and soft tissue infections (cSSTI) caused by resistant Gram-positive bacteria. Contezolid (MRX-I) markedly reduces potential for myelosuppression and monoamine oxidase inhibition (MAOI).
  • HY-12305
    Q-VD-OPh

    QVD-OPH; Quinoline-Val-Asp-Difluorophenoxymethylketone

    Caspase HIV Cancer Infection
    Q-VD-OPh is an irreversible pan-caspase inhibitor with potent antiapoptotic properties; inhibits caspase 7 with an IC50 of 48 nM and 25-400 nM for other caspases including caspase 1, 3, 8, 9, 10, and 12. Q-VD-OPh can inhibits HIV infection. Q-VD-OPh is able to cross the blood-brain barrier.
  • HY-B0497
    Niclosamide

    BAY2353

    STAT Parasite Antibiotic Infection Cancer
    Niclosamide (BAY2353) is an orally active antihelminthic agent used in parasitic infection research. Niclosamide is a STAT3 inhibitor with an IC50 of 0.25 μM in HeLa cells. Niclosamide has biological activities against cancer, inhibits DNA replication in Vero E6 cells.
  • HY-B0497A
    Niclosamide sodium

    BAY2353 sodium

    Antibiotic STAT Parasite Cancer Infection
    Niclosamide (BAY2353) sodium is an orally active antihelminthic agent used in parasitic infection research. Niclosamide sodium is a STAT3 inhibitor with an IC50 of 0.25 μM in HeLa cells. Niclosamide sodium has biological activities against cancer, and inhibits DNA replication in Vero E6 cells.
  • HY-B0497B
    Niclosamide monohydrate

    BAY2353 monohydrate

    STAT Antibiotic Parasite Cancer Infection
    Niclosamide (BAY2353) monohydrate is an orally active antihelminthic agent used in parasitic infection research. Niclosamide monohydrate is a STAT3 inhibitor with an IC50 of 0.25 μM in HeLa cells. Niclosamide monohydrate has biological activities against cancer, and inhibits DNA replication in Vero E6 cells.
  • HY-120568
    M4284

    Bacterial Infection Inflammation/Immunology
    M4284 is a selective and orally active biphenyl mannoside FimH antagonist. M4284 has activities against different UPEC (Urinary tract infections (UTI) caused by uropathogenic E. coli) strains in different host genetic backgrounds and gut microbial community contexts.
  • HY-124623
    DNDI-8219

    Parasite Infection
    DNDI-8219 (compound 58) is a potent selective and orally active trypanocidal agent, possessing inhibitory activity against Trypanosoma cruzi (T. cruzi) with an IC50 of 0.4 μM. DNDI-8219 has low cytotoxicity (L6 cells IC50 > 100 μM). DNDI-8219 can effectively cure chronic T. cruzi infection and markedly reduce parasite burdens in mouse model. DNDI-8219 has good solubility, metabolic stability and safety.
  • HY-N1836
    3-Acetonyl-3-hydroxyoxindole

    3-Hydroxy-3-acetonyloxindole

    Others Infection
    3-Acetonyl-3-hydroxyoxindole (AHO) is a potent systemic acquired resistance (SAR) inducer in plants. 3-Acetonyl-3-hydroxyoxindole induces resistance in tobacco plants against infection with tobacco mosaic virus (TMV) and the fungal pathogen Erysiphe cichoracearum. 3-Acetonyl-3-hydroxyoxindole increases the level of pathogenesis-related gene 1 (PR-1) expression, salicylic acid (SA) accumulation and phenylalanine ammonia-lyase activity.
  • HY-15356
    BIO-acetoxime

    BIA

    GSK-3 Apoptosis HSV Infection Inflammation/Immunology Neurological Disease
    BIO-acetoxime (BIA) is a potent and selective GSK-3 inhibitor, with IC50s of both 10 nM for GSK-3α/β. BIO-acetoxime has anticonvulsant and anti-infection activity.
  • HY-B1078
    Cefazolin sodium

    Cephazolin sodium

    Bacterial Antibiotic Infection Inflammation/Immunology Neurological Disease
    Cefazolin sodium is a first-generation cephalosporin antibiotic and can be used in varieties of bacterial infections research. Cefazolin sodium has anti-inflammatory effect and can attenuate post-operative cognitive dysfunction (POCD).
  • HY-B0497C
    Niclosamide olamine

    BAY2353 olamine

    STAT Parasite Antibiotic Cancer Infection
    Niclosamide (BAY2353) olamine is an orally active antihelminthic agent used in parasitic infection research. Niclosamide olamin is a STAT3 inhibitor with an IC50 of 0.25 μM in HeLa cells. Niclosamide olamin has biological activities against cancer, and inhibits DNA replication in Vero E6 cells.
  • HY-N0677
    Dehydroandrographolide succinate

    Influenza Virus Infection Inflammation/Immunology Cancer
    Dehydroandrographolide succinate, extracted from herbal medicine Andrographis paniculata (Burm f) Nees, is widely used for the treatment of viral pneumonia and viral upper respiratory tract infections because of its immunostimulatory, anti-infective and anti-inflammatory effect.
  • HY-B1892
    Cefazolin

    Cephazolin

    Antibiotic Bacterial Infection Inflammation/Immunology Neurological Disease
    Cefazolin (Cephazolin) is a first-generation cephalosporin antibiotic and can be used in varieties of bacterial infections research. Cefazolin has anti-inflammatory effect and can attenuate post-operative cognitive dysfunction (POCD).
  • HY-19827
    Aeroplysinin 1

    (+)-Aeroplysinin-1

    Bacterial HIV Apoptosis Cancer Infection
    Aeroplysinin 1 ((+)-Aeroplysinin-1), a secondary metabolite isolated from marine sponges, shows potent antibiotic effects on Gram-positive bacteria and exerts antiviral activity against HIV-1 (IC50=14.6 μM). Aeroplysinin 1 has anti-inflammatory, anti-angiogenic and anti-tumor activities. Aeroplysinin 1 induces apoptosis in endothelial cells.
  • HY-B2115
    Sulfogaiacol

    Bacterial Inflammation/Immunology
    Sulfogaiacol is a antitussive agent. Sulfogaiacol is used for acute respiratory tract infections, cough and other conditions.
  • HY-N4117
    Hamamelitannin

    Bacterial Infection
    Hamamelitannin, a polyphenol extracted from the bark of Hamamelis virginiana, is a quorum-sensing (QS) inhibitor. Hamamelitannin increases antibiotic susceptibility of staphylococcus aureus biofilms by affecting peptidoglycan biosynthesis and eDNA release.
  • HY-146023
    Antifungal agent 27

    Bacterial Fungal Infection
    Antifungal agent 27 (compound 7) is a antifungal agent. Antifungal agent 27 shows moderate antibacterial and weak antifungal activities against MRSA and C. albicans SS5314, with MIC values of 8 and 32 μg/mL, respectively.
  • HY-146024
    Antifungal agent 28

    Fungal Infection
    Antifungal agent 28 (compound 18) is a potent and selective antifungal agent. Antifungal agent 28 inhibits pathogenic strains of C. albicans and non-albicans species including fluconazole-resistant strains. Antifungal agent 28 inhibits Cryptococcus and Aspergillus strains. Antifungal agent 28 disrupts mature Candida biofilm.
  • HY-B1147
    Diloxanide furoate

    Parasite Infection
    Diloxanide furoate is the prodrug of Diloxanide. Diloxanide furoate is a potent and orally active anti-protozoal agent and can be used for the research of amebiasis, mild intestinal amebiasis or asymptomatic cyst carriers.
  • HY-17422A
    Acyclovir sodium

    Aciclovir sodium; Acycloguanosine sodium

    HSV Apoptosis Antibiotic Bacterial Cancer Infection
    Acyclovir (Aciclovir) sodium is a potent, orally active antiviral agent. Acyclovir sodium has antiherpetic activity with IC50 values of 0.85 μM and 0.86 μM for HSV-1 and HSV-2, respectively. Acyclovir sodium induces cell cycle perturbation and apoptosis. Acyclovir sodium prevents bacterial infections during induction therapy for acute leukaemia.
  • HY-146413
    HF50731

    CXCR HIV Cancer Infection
    HF50731 (compound 21) is a potent CXCR4 antagonist. HF50731 shows strong CXCR4 binding affinity, with IC50 of 19.8 nM. HF50731 effectively inhibits calcium mobilization, cell migration, and HIV-1 infection via CXCR4 coreceptor, with IC50 values of 119.2 nM, 621.4 nM and 1.5 μM.
  • HY-17422
    Acyclovir

    Aciclovir; Acycloguanosine

    HSV Apoptosis Antibiotic Bacterial Cancer Infection
    Acyclovir (Aciclovir) is a potent, orally active antiviral agent. Acyclovir has antiherpetic activity with IC50 values of 0.85 μM and 0.86 μM for HSV-1 and HSV-2, respectively. Acyclovir induces cell cycle perturbation and apoptosis. Acyclovir prevents bacterial infections during induction therapy for acute leukaemia.
  • HY-B0756
    Cefazolin sodium pentahydrate

    Cephazolin sodium pentahydrate

    Antibiotic Bacterial Infection Inflammation/Immunology Neurological Disease
    Cefazolin sodium pentahydrate is a first-generation cephalosporin antibiotic and can be used in varieties of bacterial infections research. Cefazolin sodium pentahydrate has anti-inflammatory effect and can attenuate post-operative cognitive dysfunction (POCD).
  • HY-W015591S
    Mandelic acid-2,3,4,5,6-d5

    (±)-Mandelic acid-2,3,4,5,6-d5; DL-Mandelic acid-2,3,4,5,6-d5

    Bacterial Endogenous Metabolite Infection
    Mandelic acid-2,3,4,5,6-d5 ((±)-Mandelic acid-2,3,4,5,6-d5) is the deuterium labeled Mandelic acid. Mandelic acid ((±)-Mandelic acid), an alpha-hydroxycarboxylic acid, has been widely used as an intermediate of pharmaceutical and fine chemicals. Mandelic acid shows antimicrobial activity and has been used for the research of urinary tract infections and vaginal trichomoniasis. Mandelic acid exhibits high sperm-immobilizing activity and low vaginal irritation.
  • HY-100603
    GSK-F1

    PI4K PI3K Infection
    GSK-F1 (Compound F1) is an orally active PI4KA inhibitor with pIC50 values of 8.0, 5.9, 5.8, 5.9, 5.9 and 6.4 against PI4KA, PI4KB, PI3KA, PI3KB, PI3KG and PI3KD, respectively. GSK-F1 can be used for HCV infection research.
  • HY-19915B
    Contezolid acefosamil sodium

    MRX-4 sodium

    Bacterial Antibiotic Monoamine Oxidase Infection Inflammation/Immunology
    Contezolid acefosamil sodium (MRX-4), a new and orally active oxazolidinone, is an antibiotic in study for complicated skin and soft tissue infections (cSSTI) caused by resistant Gram-positive bacteria. Contezolid acefosamil sodium (MRX-4) markedly reduces potential for myelosuppression and monoamine oxidase inhibition (MAOI).
  • HY-14648A
    Dexamethasone acetate

    Dexamethasone 21-acetate; Hexadecadrol acetate

    Glucocorticoid Receptor Autophagy Mitophagy Bacterial Inflammation/Immunology Endocrinology Cancer
    Dexamethasone acetate (Dexamethasone 21-acetate) is a glucocorticoid receptor agonist. Dexamethasone acetate has the potential for ophthalmic infections treatment.
  • HY-100751
    N-563

    Fungal Others
    N-563 is an analogue of deoxyspergualin with an immunostimulating activity,it promotes resistance to Candida albicans infection in mice.
  • HY-N1549
    Prunin

    Naringenin 7-0-glucoside

    Enterovirus Phosphatase Infection Metabolic Disease
    Prunin is a potent inhibitor of human enterovirus A71 (HEVA71). Prunin shows strong inhibitory activity against protein tyrosine phosphatase 1B (PTP1B), with an IC50 of 5.5 µM.
  • HY-P1180
    Pam3CSK4

    Pam3Cys-Ser-(Lys)4

    Toll-like Receptor (TLR) Infection Inflammation/Immunology
    Pam3CSK4 is a toll-like receptor 1/2 (TLR1/2) agonist with an EC50 of 0.47 ng/mL for human TLR1/2.
  • HY-P1405
    Pam3CSK4-Biotin

    Pam3Cys-Ser-(Lys)4-Biotin

    Toll-like Receptor (TLR) Infection Inflammation/Immunology
    Pam3CSK4-Biotin is biotinylated Pam3CSK4. Pam3CSK4-Biotin is a Toll-like receptor 1/2 (TLR1/2) agonist.
  • HY-B1370S
    Hydroxychloroquine-d4 sulfate

    HCQ-d4 sulfate

    Parasite Toll-like Receptor (TLR) SARS-CoV Autophagy Cancer Infection
    Hydroxychloroquine-d4 sulfate (HCQ-d4 sulfate) is the deuterium labeled Hydroxychloroquine sulfate. Hydroxychloroquine sulfate (HCQ sulfate) is a synthetic antimalarial agent which can also inhibit Toll-like receptor 7/9 (TLR7/9) signaling. Hydroxychloroquine sulfate is efficiently inhibits SARS-CoV-2 infection in vitro.
  • HY-147849
    JMI-105

    Parasite Infection
    JMI-105 is a potent PfFP-2 (Plasmodium falciparum falcipain-2 protease) inhibitor. JMI-105 inhibits the growth of CQ S (3D7; IC50=8.8 µM) and CQ R (RKL-9; IC50=14.3 µM) strains of P. falciparum. JMI-105 significantly decreases parasitemia and prolonged host survival in a murine model with P. berghei ANKA infection. JMI-105 has the potential to be used as an anti-malarial agent.
  • HY-B1599
    Chloramphenicol palmitate

    Bacterial Infection
    Chloramphenicol palmitate is an orally active broad spectrum antibiotic and has a broad spectrum of activity against gram positive and gram negative bacteria. Chloramphenicol palmitate inhibits bacterial protein synthesis by blocking the peptidyl transferase step. Chloramphenicol palmitate can be used as bacterial selection agent in transformed cells containing chloramphenicol resistance genes.
  • HY-W041988
    Fmoc-Glu-OMe

    Bacterial Infection
    Fmoc-Glu-OMe, a glutamic acid derivative, shows antibacterial activity and gelation property in AgNO3 solution. Fmoc-Glu-OMe is a mouldable wound healing biomaterial.
  • HY-144334
    CHIKV-IN-3

    DNA/RNA Synthesis Infection
    CHIKV-IN-3 is a potent against two low-passage CHIKV inhibitor with EC50 values of 1.55 and 0.14 µM for CHIKV-122508 and CHIKV-6708, respectively. CHIKV-IN-3 acts on the host cells to interfere with the viral replication. CHIKV-IN-3 displays minimal cytotoxic liability(CC50 > 100 µM). Prophylactic effect.
  • HY-135853
    Molnupiravir

    EIDD-2801; MK-4482

    SARS-CoV Influenza Virus Infection
    Molnupiravir (EIDD-2801) is an orally bioavailable prodrug of the ribonucleoside analog EIDD-1931. Molnupiravir has broad spectrum antiviral activity against influenza virus and multiple coronaviruses, such as SARS-CoV-2, MERS-CoV, SARS-CoV. Molnupiravir has the potential for the research of COVID-19, and seasonal and pandemic influenza.
  • HY-N0677A
    Kalii Dehydrographolidi Succinas

    Potassium dehydroandrographolide succinate

    Others Infection Inflammation/Immunology Cancer
    Kalii Dehydrographolidi Succinas (Potassium dehydroandrographolide succinate), extracted from herbal medicine Andrographis paniculata (Burm f) Nees, is widely used for the treatment of viral pneumonia and viral upper respiratory tract infections because of its immunostimulatory, anti-infective and anti-inflammatory effect.
  • HY-N0158
    Oxymatrine

    TGF-beta/Smad Influenza Virus Cancer Infection Inflammation/Immunology
    Oxymatrine, an alkaloid from the roots of Sophora species, with anti-inflammatory, antifibrosis, and antitumor effects, inhibits the iNOS expression and TGF-β/Smad pathway. Oxymatrine inhibits bocavirus minute virus of canines (MVC) replication, reduces viral gene expression and decreases apoptosis induced by viral infection.
  • HY-N7378A
    N-Hydroxypipecolic acid potassium

    1-Hydroxy-2-piperidinecarboxylic acid potassium; NHP potassium

    Others Inflammation/Immunology
    N-Hydroxypipecolic acid potassium (1-Hydroxy-2-piperidinecarboxylic acid potassium), a plant metabolite and a systemic acquired resistance (SAR) regulator, orchestrates SAR establishment in concert with the immune signal salicylic acid. N-Hydroxypipecolic acid potassium accumulates systemically in the plant foliage in response to pathogen attack. N-Hydroxypipecolic acid potassium induces SAR to bacterial and oomycete infection.
  • HY-N7378
    N-Hydroxypipecolic acid

    1-Hydroxy-2-piperidinecarboxylic acid; NHP

    Others Inflammation/Immunology
    N-Hydroxypipecolic acid (1-Hydroxy-2-piperidinecarboxylic acid), a plant metabolite and a systemic acquired resistance (SAR) regulator, orchestrates SAR establishment in concert with the immune signal salicylic acid. N-Hydroxypipecolic acid accumulates systemically in the plant foliage in response to pathogen attack. N-Hydroxypipecolic acid induces SAR to bacterial and oomycete infection.
  • HY-N4331
    Rivulariapeptolides 1185

    Others Cancer Infection
    Rivulariapeptolides 1185 is a high potent and selective serine protease inhibitor with IC50 values of 13.17 nM, 23.59 nM and 55.26 nM for chymotrypsin, elastase and proteinase K, respectively.
  • HY-N4333
    Rivulariapeptolides 988

    Others Ser/Thr Protease Cancer Infection
    Rivulariapeptolides 988 is a high potent and selective serine protease inhibitor with IC50 values of 95.46 nM, 15.29 nM and 85.50 nM for chymotrypsin, elastase and proteinase K, respectively.
  • HY-109195
    Vebicorvir

    ABI-H0731

    HBV Infection Inflammation/Immunology
    Vebicorvir (ABI-H0731) is a first-generation hepatitis B virus (HBV) core protein inhibitor. Vebicorvir (ABI-H0731) suppresses covalently closed circular DNA (cccDNA) formation in two de novo infection models with EC50s from 1.84 μM to 7.3 μM.
  • HY-15311
    Avermectin B1

    Abamectin; Avermectin B1a-Avermectin B1b mixt.

    Parasite Autophagy Apoptosis Reactive Oxygen Species Infection Inflammation/Immunology
    Avermectin B1 (Abamectin) is a mixture of two similar segments of avermectin. Avermectin B1 is an orally anti-infection agent, which can be used in the research of parasitic worms, insect pests, agriculture and animal husbandry. Avermectin B1 can also induce the production of ROS and induces cytotoxicity, apoptosis and autophagy.
  • HY-B0097
    Floxuridine

    5-Fluorouracil 2'-deoxyriboside

    Nucleoside Antimetabolite/Analog DNA/RNA Synthesis Bacterial CMV HSV Apoptosis Cancer Infection
    Floxuridine (5-Fluorouracil 2'-deoxyriboside) is a pyrimidine analog and known as an oncology antimetabolite. Floxuridine inhibits Poly(ADP-Ribose) polymerase and induces DNA damage by activating the ATM and ATR checkpoint signaling pathways in vitro. Floxuridine is a extreamly potent inhibitor for S. aureus infection and induces cell apoptosis. Floxuridine has antiviral effects against HSV and CMV.
  • HY-137565
    Hydroxy ritonavir

    Drug Metabolite Others
    Hydroxy ritonavir is a metabolite of Ritonavir. Ritonavir is an inhibitor of HIV protease used to treat HIV infection and AIDS.
  • HY-P2251
    T-peptide

    HIV Microtubule/Tubulin Cancer Infection Inflammation/Immunology
    T-peptide, a Tuftsin analog, can be used for the research of human immunodeficiency virus (HIV) infection. T-peptide prevents cellular immunosuppression and improves survival rate in septic mice. T-peptide also can inhibit the growth of residual tumor cells after surgical resection.
  • HY-124662
    IHVR-19029

    Glucosidase Infection
    IHVR-19029 is a potent endoplasmic reticulum (ER) α-glucosidases I and II inhibitor, with an IC50 of 0.48 μM for ER a-glucosidase I. IHVR-19029 efficiently blocks the replication of several hemorrhagic fever viruses, such as Dengue virus (DENV), Ebola virus (EBOV) and Rift Valley fever virus. The combination of IHVR-19029 with Favipiravir (HY-14768) improves the antiviral efficacy.
  • HY-150044
    Type II topoisomerase inhibitor 1

    DNA/RNA Synthesis Topoisomerase Bacterial Infection
    Type II topoisomerase inhibitor 1 is a potent and selective E. coli DNA gyrase inhibitor (IC50: 1.7 nM), and forms hydrogen bonds with Asp73 residue. Type II topoisomerase inhibitor 1 inhibits topoisomerase IV activity (IC50: 0.98 μM). Type II topoisomerase inhibitor 1 can be used in the research of antibacterial area.
  • HY-B0519B
    Tylosin phosphate

    Bacterial Antibiotic Infection
    Tylosin phosphate is a macrolide antibiotic found naturally as a fermentation product of Streptomyces fradiae. Tylosin tartrate exerts potent antimicrobial activity against Gram-positive bacteria. Tylosin phosphate is widely used as a feed additive for promoting animal growth. Tylosin phosphate is used for veterinary purposes against bacterial dysentery and respiratory diseases in poultry, pigs and cattle.
  • HY-B0519A
    Tylosin

    Tylosin A

    Bacterial Antibiotic Infection
    Tylosin (Tylosin A) is a macrolide antibiotic found naturally as a fermentation product of Streptomyces fradiae. Tylosin exerts potent antimicrobial activity against Gram-positive bacteria. Tylosin is widely used as a feed additive for promoting animal growth. Tylosin is used for veterinary purposes against bacterial dysentery and respiratory diseases in poultry, pigs and cattle.
  • HY-B0519
    Tylosin tartrate

    Bacterial Antibiotic Infection
    Tylosin tartrate is a macrolide antibiotic found naturally as a fermentation product of Streptomyces fradiae. Tylosin tartrate exerts potent antimicrobial activity against Gram-positive bacteria. Tylosin tartrate is widely used as a feed additive for promoting animal growth. Tylosin tartrate is used for veterinary purposes against bacterial dysentery and respiratory diseases in poultry, pigs and cattle.
  • HY-P2320
    IDR-1

    Bacterial Infection Inflammation/Immunology
    IDR-1 is an antimicrobial peptide that is active against Gram-positive and Gram-negative bacteria. IDR-1 counters infection by selective modulation of innate immunity without obvious toxicities. IDR-1 has anti-inflammatory and anti-infective properties, enhances the levels of monocyte chemokines, and attenuates pro-inflammatory cytokine release.
  • HY-B0307
    Idoxuridine

    5-Iodo-2′-deoxyuridine; 5-IUdR; IdUrd

    Phosphatase Orthopoxvirus Infection Cancer
    Idoxuridine (5-Iodo-2′-deoxyuridine, 5-IUdR, IdUrd) is an iodinated thymidine analogue that competitively inhibits phosphorylases. Idoxuridine can inhibit viral activity, particularly viral eye infections, including herpes simplex keratitis, by inhibiting DNA polymerase and affecting viral replication. Idoxuridine against feline herpesvirus has the IC50 value of 4.3 μM. Idoxuridine shows anti-orthopoxvirus activity.
  • HY-120072
    PF-3450074

    PF-74

    HIV Infection
    PF-3450074 (PF-74) is a specifical inhibitor of HIV-1 capsid protein (CA) and displays a broad-spectrum inhibition of HIV isolates with submicromolar potency (EC50=8-640 nM). PF-3450074 (PF-74) acts at an early stage of HIV-1 infection, inhibits viral replication by directly competing with the binding of CPSF6 and NUP153, and blocks the uncoating, assembly, and the reverse transcription steps of the viral life cycle. CPSF6: nuclear host factors cleavage and polyadenylation specific factor 6; NUP153: nucleoporin 153.
  • HY-122920
    Soyasaponin II

    HSV CMV Influenza Virus HIV NOD-like Receptor (NLR) Infection Inflammation/Immunology
    Soyasaponin II is a saponin with antiviral activity. Soyasaponin II inhibits the replication of HSV-1, HCMV, influenza virus, and HIV-1. Soyasaponin II shows potent inhibition on HSV-1 replication. Soyasaponin II serves as a inhibitor for YB-1 phosphorylation and NLRP3 inflammasome priming and could protect mice against LPS/GalN induced acute liver failure.
  • HY-129047
    Trypsin

    Protease Activated Receptor (PAR) Infection Inflammation/Immunology
    Trypsin is an enzyme that hydrolyzes proteins at the carboxyl side of the Lysine or Arginine. Trypsin activates PAR2 and PAR4. Trypsin induces cell-to-cell membrane fusion in PDCoV infection by the interaction of S glycoprotein of PDCoV and pAPN. Trypsin also promotes cell proliferation and differentiation. Trypsin can be used in the research of wound healing and neurogenic inflammation.
  • HY-B1148
    Furaltadone hydrochloride

    Altafur hydrochloride

    Bacterial Parasite Inflammation/Immunology
    Furaltadone hydrochloride, a nitrofuran drug, has the potential for the study in infections of chickens with salmonella enteritidis. Furaltadone is inhibitory and bactericidal in vitro for staphylococci .
  • HY-151134
    HBV-IN-25

    HBV Infection
    HBV-IN-25 is a good potency, orally active novel HBV cccDNA reducer. HBV-IN-25 has anti-HBeAg potency and anti-HBV activity with IC50 values of 0.58 μM and 1.15 μM, respectively. HBV-IN-25 has good aqueous solubility (LYSA>452 μg/mL) and good PK property with no cellular toxicity.
  • HY-15654
    Sodium 4-phenylbutyrate

    4-PBA sodium; 4-Phenylbutyric acid sodium; Benzenebutyric acid sodium

    HDAC Autophagy Apoptosis Cancer
    Sodium 4-phenylbutyrate (4-PBA sodium) is an inhibitor of HDAC and endoplasmic reticulum (ER) stress, used in cancer and infection research.
  • HY-N0736
    Coptisine chloride

    Indoleamine 2,3-Dioxygenase (IDO) Bacterial Influenza Virus Cancer Infection Metabolic Disease
    Coptisine chloride is an alkaloid from Chinese goldthread, and acts as an efficient uncompetitive IDO inhibitor with a Ki value of 5.8 μM and an IC50 value of 6.3 μM. Coptisine chloride is a potent H1N1 neuraminidase (NA-1) inhibitor with an IC50 of 104.6 μg/mL and can be used for influenza A (H1N1) infection.
  • HY-13560
    AVN-944

    VX-944

    Arenavirus DNA/RNA Synthesis Apoptosis Caspase Bcl-2 Family Cancer Infection
    AVN-944 (VX-944) is an orally active, potent, selective, noncompetitive and specific inhibitor of IMPDH (inosine monophosphate dehydrogenase). AVN-944 is an essential rate-limiting enzyme in de novo guanine nucleotide synthesis. AVN-944 is also an inhibitor of arenavirus RNA synthesis, and blocks arenavirus infection. AVN-944 has broad anti-cancer activities, and can be used for multiple myeloma (MM) and acute myeloid leukemia (AML) research.
  • HY-108307
    Micronomicin sulfate

    Gentamicin C2b sulfate; Antibiotic XK-62-2 sulfate; Sagamicin sulfate

    Antibiotic Bacterial Infection
    Micronomicin sulfate (Gentamicin C2b sulfate) is an aminoglycoside antibiotic isolated from Micromonospora. Micronomicin sulfate is a broad-spectrum antibiotic close to the gentamicin-type antibiotics, exhibits a high activity against Pseudomonas, Proteus, Klebsiella pneumoniae, Serratia, etc (MIC=0.001-8.3 μg/ml).
  • HY-107760
    Decanoyl-RVKR-CMK

    DecRVKRcmk

    HIV Infection Inflammation/Immunology
    Decanoyl-RVKR-CMK (DecRVKRcmk) inhibits over-expressed gp160 processing and HIV-1 replication.
  • HY-107760A
    Decanoyl-RVKR-CMK TFA

    DecRVKRcmk TFA

    HIV Infection Inflammation/Immunology
    Decanoyl-RVKR-CMK (DecRVKRcmk) TFA inhibits over-expressed gp160 processing and HIV-1 replication.
  • HY-100500S
    Lenampicillin-d5 hydrochloride

    Bacterial Cancer
    Lenampicillin-d5 (KBT 1585-d5) hydrochloride is the deuterium labeled Lenampicillin hydrochloride. Lenampicillin hydrochloride (KBT 1585 hydrochloride) is an orally active prodrug of Ampicillin and is an effective beta-lactam antibacterial agent that inhibits bacterial penicillin-binding proteins (transpeptidase). Lenampicillin hydrochloride has improved absorption and decreased side effects compares to Ampicillin and is applied in the investigation of the suppurative skin and soft tissue infection.
  • HY-109004A
    (S)-Enzaplatovir

    (S)-BTA-C585

    RSV Cancer
    (S)-Enzaplatovir ((S)-BTA-C585) is the S-enantiomer of Enzaplatovir. (S)-Enzaplatovir shows antiviral activities with an EC50 of 56 nM for respiratory syncytial viral (RSV) (patent WO2011094823A1 compound 77).
  • HY-13718
    Oglufanide

    H-Glu-Trp-OH; L-Glutamyl-L-tryptophan

    VEGFR HCV Endogenous Metabolite Cancer Infection Inflammation/Immunology Cardiovascular Disease
    Oglufanide (H-Glu-Trp-OH) is a dipeptide immunomodulator isolated from calf thymus. Oglufanide inhibits vascular endothelial growth factor (VEGF). Oglufanide can stimulate the immune response to hepatitic C virus (HCV) and intracellular bacterial infections. Oglufanide shows antitumor and anti-angiogenesis activities.
  • HY-13062A
    Daunorubicin

    Daunomycin; RP 13057; Rubidomycin

    Topoisomerase DNA/RNA Synthesis ADC Cytotoxin Autophagy Bacterial Antibiotic Apoptosis Cancer Infection Neurological Disease
    Daunorubicin (Daunomycin) is a topoisomerase II inhibitor with potent anti-tumor activity. Daunorubicin inhibits DNA and RNA synthesis. Daunorubicin is a cytotoxin that inhibits cancer cell viability and induces apoptosis and necrosis. Daunorubicin is also an anthracycline antibiotic. Daunorubicin can be used in the research of infection and variety of cancers, including leukemia, non-Hodgkin lymphomas, Ewing's sarcoma, Wilms' tumor.
  • HY-13062
    Daunorubicin hydrochloride

    Daunomycin hydrochloride; RP 13057 hydrochloride; Rubidomycin hydrochloride

    Topoisomerase DNA/RNA Synthesis ADC Cytotoxin Bacterial Autophagy Apoptosis Antibiotic Cancer Infection Neurological Disease
    Daunorubicin (Daunomycin) hydrochloride is a topoisomerase II inhibitor with potent anti-tumor activity. Daunorubicin hydrochloride inhibits DNA and RNA synthesis. Daunorubicin hydrochloride is a cytotoxin that inhibits cancer cell viability and induces apoptosis and necrosis. Daunorubicin hydrochloride is also an anthracycline antibiotic. Daunorubicin hydrochloride can be used in the research of infection and variety of cancers, including leukemia, non-Hodgkin lymphomas, Ewing's sarcoma, Wilms' tumor.
  • HY-17589AS
    Chloroquine-d5

    Parasite Autophagy SARS-CoV Toll-like Receptor (TLR) HIV Cancer Infection Inflammation/Immunology
    Chloroquine D5 is deuterium labeled Chloroquine. Chloroquine is an antimalarial and anti-inflammatory agent widely used to treat malaria and rheumatoid arthritis. Chloroquine is an autophagy and toll-like receptors (TLRs) inhibitor. Chloroquine is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC50=1.13 μM).
  • HY-17589S1
    Chloroquine-d4 phosphate

    Parasite Autophagy SARS-CoV Toll-like Receptor (TLR) HIV Antibiotic Cancer Infection Inflammation/Immunology
    Chloroquine-d4 phosphate is the deuterium labeled Chloroquine phosphate. Chloroquine phosphate is an antimalarial and anti-inflammatory agent widely used to treat malaria and rheumatoid arthritis. Chloroquine phosphate is an autophagy and toll-like receptors (TLRs) inhibitor. Chloroquine phosphate is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC50=1.13 μM).
  • HY-16050
    Plitidepsin

    Aplidine

    DNA/RNA Synthesis SARS-CoV Cancer Infection
    Plitidepsin (Aplidine) is a potent anti-cancer agent by targeting eEF1A2 ( KD=80 nM). Plitidepsin possesses antiviral activity and is against SARS-CoV-2 with an IC90 of 0.88 nM. Plitidepsin is usually used for multiple myeloma and advanced cancer research, and has the potential for COVID-19 research.
  • HY-B0985
    Phenazopyridine hydrochloride

    Others Others
    Phenazopyridine hydrochloride is a chemical, which has a local analgesic effect, often used to alleviate the pain, irritation, discomfort, or urgency caused by urinary tract infections, surgery, or injury to the urinary tract.
  • HY-N2840
    Allitol

    Allodulcitol

    Others Cancer Metabolic Disease
    Allitol is a rare natural polyol that can be used as a sweetener. Allitol is an important intermediate for the preparation of the agents which against diabetes, cancer, and viral infections, including AIDS.
  • HY-17589S
    Chloroquine-d5 diphosphate

    Parasite Autophagy SARS-CoV Toll-like Receptor (TLR) HIV Antibiotic Cancer Infection Inflammation/Immunology
    Chloroquine-d5 diphosphate is the deuterium labeled Chloroquine (phosphate). Chloroquine phosphate is an antimalarial and anti-inflammatory agent widely used to treat malaria and rheumatoid arthritis. Chloroquine phosphate is an autophagy and toll-like receptors (TLRs) inhibitor. Chloroquine phosphate is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC50=1.13 μM).
  • HY-14648
    Dexamethasone

    Hexadecadrol; Prednisolone F

    Glucocorticoid Receptor SARS-CoV Autophagy Complement System Mitophagy Bacterial Antibiotic Cancer Infection Endocrinology Inflammation/Immunology
    Dexamethasone (Hexadecadrol) is a glucocorticoid receptor agonist. Dexamethasone also significantly decreases CD11b, CD18, and CD62L expression on neutrophils, and CD11b and CD18 expression on monocytes. Dexamethasone is highly effective in the control of COVID-19 infection. Dexamethasone inhibits production of exosomes containing inflammatory microRNA-155 in lipopolysaccharide-induced macrophage inflammatory responses.
  • HY-17422S1
    Acyclovir-d4

    Aciclovir-d4; Acycloguanosine-d4

    HSV Bacterial Apoptosis Antibiotic Cancer Infection
    Acyclovir-d4 (Aciclovir-d4) is the deuterium labeled Acyclovir. Acyclovir (Aciclovir) is a guanosine analogue and an orally active antiviral agent. Acyclovir inhibits HSV-1 (IC50 of 0.85 μM), HSV-2 (IC50 of 0.86 μM) and varicella-zoster virus. Acyclovir can be phosphorylated by viral thymidine kinase (TK), and Acyclovir triphosphate interferes with viral DNA polymerization through competitive inhibition with guanosine triphosphate and obligatory chain termination. Acyclovir prevents bacterial infections during induction therapy for acute leukaemia.
  • HY-17422S
    Acyclovir-d4 L-Leucinate

    HSV Bacterial Apoptosis Antibiotic Cancer Infection
    Acyclovir-d4 L-Leucinate is the deuterium labeled Acyclovir. Acyclovir (Aciclovir) is a guanosine analogue and an orally active antiviral agent. Acyclovir inhibits HSV-1 (IC50 of 0.85 μM), HSV-2 (IC50 of 0.86 μM) and varicella-zoster virus. Acyclovir can be phosphorylated by viral thymidine kinase (TK), and Acyclovir triphosphate interferes with viral DNA polymerization through competitive inhibition with guanosine triphosphate and obligatory chain termination. Acyclovir prevents bacterial infections during induction therapy for acute leukaemia.
  • HY-108876
    Daunorubicin citrate

    Daunomycin(citrate); RP 13057(citrate); Rubidomycin(citrate)

    Topoisomerase DNA/RNA Synthesis ADC Cytotoxin Autophagy Bacterial Antibiotic Apoptosis Cancer Infection Neurological Disease
    Daunorubicin (Daunomycin) citrate is a topoisomerase II inhibitor with potent anti-tumor activity. Daunorubicin citrate inhibits DNA and RNA synthesis. Daunorubicin citrate is a cytotoxin that inhibits cancer cell viability and induces apoptosis and necrosis. Daunorubicin citrate is also an anthracycline antibiotic. Daunorubicin citrate can be used in the research of infection and variety of cancers, including leukemia, non-Hodgkin lymphomas, Ewing's sarcoma, Wilms' tumor.
  • HY-106934
    Peldesine

    BCX 34

    Nucleoside Antimetabolite/Analog HIV Cancer Infection Inflammation/Immunology
    Peldesine (BCX 34) is a potent, competitive, reversible and orally active purine nucleoside phosphorylase (PNP) inhibitor with IC50s of 36 nM, 5 nM, and 32 nM for human, rat, and mouse red blood cell (RBC) PNP, respectively. Peldesine is also a T-cell proliferation inhibitor with an IC50 of 800 nM. Peldesine has the potential for cutaneous T-cell lymphoma, psoriasis and HIV infection research.
  • HY-106934A
    Peldesine dihydrochloride

    BCX 34 dihydrochloride

    Nucleoside Antimetabolite/Analog HIV Cancer Infection Inflammation/Immunology
    Peldesine (BCX 34) dihydrochloride is a potent, competitive, reversible and orally active purine nucleoside phosphorylase (PNP) inhibitor with IC50s of 36 nM, 5 nM, and 32 nM for human, rat, and mouse red blood cell (RBC) PNP, respectively. Peldesine dihydrochloride is also a T-cell proliferation inhibitor with an IC50 of 800 nM. Peldesine dihydrochloride has the potential for cutaneous T-cell lymphoma, psoriasis and HIV infection research.
  • HY-78131C
    Ibuprofen sodium

    (±)-Ibuprofen sodium

    COX Apoptosis Cancer Infection Inflammation/Immunology Neurological Disease
    Ibuprofen ((±)-Ibuprofen) sodium is an orally active, selective COX-1 inhibitor with an IC50 value of 13 μM. Ibuprofen sodium inhibits cell proliferation, angiogenesis, and induces cell apoptosis. Ibuprofen sodium is a nonsteroidal anti-inflammatory agent and a nitric oxide (NO) donor. Ibuprofen sodium can be used in the research of pain, swelling, inflammation, infection, immunology, cancers.
  • HY-B0985A
    Phenazopyridine

    Others Others
    Phenazopyridine has a local analgesic effect on the urinary tract, often used to alleviate the pain, irritation, discomfort, or urgency caused by urinary tract infections, surgery, or injury to the urinary tract.
  • HY-78131
    Ibuprofen

    (±)-Ibuprofen

    COX Apoptosis Cancer Infection Inflammation/Immunology Neurological Disease
    Ibuprofen ((±)-Ibuprofen) is a potent, orally active, selective COX-1 inhibitor with an IC50 value of 13 μM. Ibuprofen inhibits cell proliferation, angiogenesis, and induces cell apoptosis. Ibuprofen is a nonsteroidal anti-inflammatory agent and a nitric oxide (NO) donor. Ibuprofen ((±)-Ibuprofen) can be used in the research of pain, swelling, inflammation, infection, immunology, cancers.
  • HY-100586
    Ibuprofen L-lysine

    (±)-Ibuprofen L-lysine

    COX Apoptosis Cancer Infection Inflammation/Immunology
    Ibuprofen ((±)-Ibuprofen) L-lysine is a potent orally active, selective COX-1 inhibitor with an IC50 value of 13 μM. Ibuprofen L-lysine inhibits cell proliferation, angiogenesis, and induces cell apoptosis. Ibuprofen L-lysine is a nonsteroidal anti-inflammatory agent and a nitric oxide (NO) donor. Ibuprofen L-lysine can be used in the research of pain, swelling, inflammation, infection, immunology, cancers.
  • HY-18684
    SIBA

    5'-Isobutylthioadenosine; 5'-Deoxy-5'-isobutylthioadenosine

    Nucleoside Antimetabolite/Analog HSV Parasite Cancer Infection Metabolic Disease
    SIBA (5'-Isobutylthioadenosine) is a transmethylation inhibitor (SAH (HY-19528) analogue), with potent anti-proliferative activity. SIBA reversibly inhibits the production of HSV-1 by blocking methylation, specifically by blocking the 5' end-capping of viral mRNA. SIBA also inhibits the growth of tumour cells in vitro and metastatic spread in vivo. SIBA can be used in cancer, HSV-1 infection and anti-malaria studies.
  • HY-150509
    Apratoxin S4

    Apra S4

    Others Cancer Infection Cardiovascular Disease
    Apratoxin S4 (Apra S4) is a potent Sec61 inhibitor that prevents cotranslational translocation of secretory proteins into the endoplasmic reticulum (ER). Apratoxin S4 has antiviral effects against some flaviviruses with IC50 values ranging from 0.46 nM to 170 nM, and inhibits retinal vascular cell activation by suppressing multiple angiogenic pathways. Apratoxin S4 can be used for the research of viral infections, angiogenic diseases and cancers.
  • HY-N1487
    Oleanonic acid

    3-Oxooleanolic acid

    HIV Cancer
    Oleanonic acid (3-Oxooleanolic acid) is a triterpenoid, inhibits infection by HIV-1 in in vitro infected PBMC, naturally infected PBMC and monocyte/macrophages with EC50 of 22.7 mM, 24.6 mM and 57.4 mM, respectively.
  • HY-100083
    Dolutegravir intermediate-1

    HIV Others
    Dolutegravir intermediate-1 is a synthetic intermediate of Dolutegravir extracted from patent WO 2016125192 A2. Dolutegravir is an integrase inhibitor developed for the treatment of human immunodeficiency virus (HIV)-1 infection.
  • HY-144639
    Carbonic anhydrase inhibitor 5

    Carbonic Anhydrase Cancer Infection Inflammation/Immunology
    Carbonic anhydrase inhibitor 5 is a potent and selective human carbonic anhydrase (hCA) inhibitor with IC50s of 42.9, 47,6 and 6.7 nM for hCA II, hCA IX and hCA XII, respectively.
  • HY-15654S
    Phenylbutyrate-d11 sodium

    4-PBA-d11 sodium; 4-Phenylbutyric acid-d11 sodium; Benzenebutyric acid-d11 sodium

    HDAC Autophagy Apoptosis Cancer
    Phenylbutyrate-d11 (sodium) is deuterium labeled Sodium 4-phenylbutyrate. Sodium 4-phenylbutyrate (4-PBA sodium) is an inhibitor of HDAC and endoplasmic reticulum (ER) stress, used in cancer and infection research.
  • HY-14648S2
    Dexamethasone-d4

    Hexadecadrol-d4; Prednisolone F-d4

    Glucocorticoid Receptor SARS-CoV Autophagy Complement System Mitophagy Bacterial Antibiotic Cancer Infection Endocrinology Inflammation/Immunology
    Dexamethasone-d4 is deuterium labeled Dexamethasone. Dexamethasone (Hexadecadrol) is a glucocorticoid receptor agonist. Dexamethasone also significantly decreases CD11b, CD18, and CD62L expression on neutrophils, and CD11b and CD18 expression on monocytes. Dexamethasone is highly effective in the control of COVID-19 infection. Dexamethasone inhibits production of exosomes containing inflammatory microRNA-155 in lipopolysaccharide-induced macrophage inflammatory responses.
  • HY-14648S1
    Dexamethasone-d5-1

    Hexadecadrol-d5-1; Prednisolone F-d5-1

    Glucocorticoid Receptor SARS-CoV Autophagy Complement System Mitophagy Bacterial Antibiotic Cancer Infection Endocrinology Inflammation/Immunology
    Dexamethasone-d5-1 is deuterium labeled Dexamethasone. Dexamethasone (Hexadecadrol) is a glucocorticoid receptor agonist. Dexamethasone also significantly decreases CD11b, CD18, and CD62L expression on neutrophils, and CD11b and CD18 expression on monocytes. Dexamethasone is highly effective in the control of COVID-19 infection. Dexamethasone inhibits production of exosomes containing inflammatory microRNA-155 in lipopolysaccharide-induced macrophage inflammatory responses.
  • HY-P2290
    Beta-defensin 1, pig

    Bacterial Infection Inflammation/Immunology
    Beta-defensin 1, pig is an antimicrobial peptide found primarily in tongue mucosa of pig. Beta-defensin 1, pig is active against bacteria such as Escherichia coli, Salmonella typhimurium, Listeria monocytogenes, Staphylococcus aureus, Bordetella pertussis and Candida albicans.
  • HY-P2290A
    Beta-defensin 1, pig TFA

    Bacterial Infection Inflammation/Immunology
    Beta-defensin 1, pig TFA is an antimicrobial peptide found primarily in tongue mucosa of pig. Beta-defensin 1, pig TFA is active against bacteria such as Escherichia coli, Salmonella typhimurium, Listeria monocytogenes, Staphylococcus aureus, Bordetella pertussis and Candida albicans.
  • HY-125445
    PCTR1

    Others Inflammation/Immunology
    PCTR1 is a potent monocyte/macrophage agonist, regulating key anti-inflammatory and pro-resolving processes during bacterial infection. PCTR1 is a member of the protectin family of specialized pro-resolving mediators (SPMs).
  • HY-144694
    HDAC/HSP90-IN-3

    HSP HDAC Fungal Infection
    HDAC/HSP90-IN-3 (compound J5) is a potent and selective fungal Hsp90 and HDAC dual inhibitor, with IC50 values of 0.83 and 0.91 μM, respectively. HDAC/HSP90-IN-3 shows antifungal activity against azole resistant C. albicans. HDAC/HSP90-IN-3 can suppress important virulence factors and down-regulate drug-resistant genes ERG11 and CDR1.
  • HY-13637B
    Ganciclovir hydrate

    BW-759 hydrate; 2'-Nor-2'-deoxyguanosine hydrate

    CMV HSV Antibiotic Nucleoside Antimetabolite/Analog Cancer Infection
    Ganciclovir (BW 759) hydrate, a nucleoside analogue, is an orally active antiviral agent with activity against CMV. Ganciclovir hydrate also has activity in vitro against members of the herpes group and some other DNA viruses. Ganciclovir hydrate inhibits the in vitro replication of human herpes viruses (HSV 1 and 2, CMV) and adenovirus serotypes 1, 2, 4, 6, 8, 10, 19, 22 and 28. Ganciclovir hydrate has an IC50 of 5.2 μM for feline herpesvirus type-1 (FHV-1) and can diffuse into the brain.
  • HY-13637
    Ganciclovir

    BW 759; 2'-Nor-2'-deoxyguanosine

    CMV HSV Antibiotic Nucleoside Antimetabolite/Analog Infection Cancer
    Ganciclovir (BW 759), a nucleoside analogue, is an orally active antiviral agent with activity against CMV. Ganciclovir also has activity in vitro against members of the herpes group and some other DNA viruses. Ganciclovir inhibits the in vitro replication of human herpes viruses (HSV 1 and 2, CMV) and adenovirus serotypes 1, 2, 4, 6, 8, 10, 19, 22 and 28. Ganciclovir has an IC50 of 5.2 μM for feline herpesvirus type-1 (FHV-1) and can diffuse into the brain.
  • HY-13637A
    Ganciclovir sodium

    BW 759 sodium; 2'-Nor-2'-deoxyguanosine sodium

    CMV HSV Antibiotic Nucleoside Antimetabolite/Analog Infection Cancer
    Ganciclovir (BW 759) sodium, a nucleoside analogue, is an orally active antiviral agent with activity against CMV. Ganciclovir sodium also has activity in vitro against members of the herpes group and some other DNA viruses. Ganciclovir sodium inhibits the in vitro replication of human herpes viruses (HSV 1 and 2, CMV) and adenovirus serotypes 1, 2, 4, 6, 8, 10, 19, 22 and 28. Ganciclovir sodium has an IC50 of 5.2 μM for feline herpesvirus type-1 (FHV-1) and can diffuse into the brain.
  • HY-19727A
    FOY 251

    Ser/Thr Protease SARS-CoV Metabolic Disease
    FOY 251, an anti-proteolytic active metabolite Camostate (HY-13512), acts as a proteinase inhibitor. FOY 251 inhibits SARS-CoV-2 infection in cells assay.
  • HY-A0061
    Trifluridine

    Trifluorothymidine; 5-Trifluorothymidine; TFT

    Thymidylate Synthase HSV Nucleoside Antimetabolite/Analog Orthopoxvirus Cancer
    Trifluridine (Trifluorothymidine; 5-Trifluorothymidine; TFT) is an irreversible thymidylate synthase inhibitor, and thereby suppresses DNA synthesis. Trifluridine is an antiviral drug for herpes simplex virus (HSV) infection. Trifluorothymidine also has anti-orthopoxvirus activity.
  • HY-14648S
    Dexamethasone-d5

    Hexadecadrol-d5; Prednisolone F-d5

    Glucocorticoid Receptor SARS-CoV Autophagy Complement System Mitophagy Bacterial Antibiotic Cancer Infection Endocrinology Inflammation/Immunology
    Dexamethasone-d5 (Hexadecadrol-d5) is the deuterium labeled Dexamethasone. Dexamethasone (Hexadecadrol) is a glucocorticoid receptor agonist. Dexamethasone also significantly decreases CD11b, CD18, and CD62L expression on neutrophils, and CD11b and CD18 expression on monocytes. Dexamethasone is highly effective in the control of COVID-19 infection. Dexamethasone inhibits production of exosomes containing inflammatory microRNA-155 in lipopolysaccharide-induced macrophage inflammatory responses.
  • HY-10585
    Valproic acid

    VPA; 2-Propylpentanoic Acid

    HDAC Autophagy Mitophagy HIV Notch Apoptosis Endogenous Metabolite Cancer Infection Metabolic Disease Neurological Disease
    Valproic acid (VPA) is an orally active HDAC inhibitor, with IC50 in the range of 0.5 and 2 mM, also inhibits HDAC1 (IC50, 400 μM), and induces proteasomal degradation of HDAC2. Valproic acid activates Notch1 signaling and inhibits proliferation in small cell lung cancer (SCLC) cells. Valproic acid is used in the treatment of epilepsy, bipolar disorder, metabolic disease, HIV infection and prevention of migraine headaches.
  • HY-10585A
    Valproic acid sodium

    Sodium Valproate sodium

    HDAC Autophagy Mitophagy HIV Notch Apoptosis Endogenous Metabolite Cancer Infection Metabolic Disease Neurological Disease
    Valproic acid (Sodium Valproate) sodium is an orally active HDAC inhibitor, with IC50 in the range of 0.5 and 2 mM, also inhibits HDAC1 (IC50, 400 μM), and induces proteasomal degradation of HDAC2. Valproic acid sodium activates Notch1 signaling and inhibits proliferation in small cell lung cancer (SCLC) cells. Valproic acid sodium is used in the treatment of epilepsy, bipolar disorder, metabolic disease, HIV infection and prevention of migraine headaches.
  • HY-P3437
    Dabcyl-KTSAVLQSGFRKM-Glu(Edans)-NH2

    Virus Protease Others
    Dabcyl-KTSAVLQSGFRKM-Glu(Edans)-NH2 is a fluorogenic peptide, as the substrate to measure the enzymatic activities of protease forms. Dabcyl-KTSAVLQSGFRKM-Glu(Edans)-NH2 can be used for researching 2019-nCoV (COVID-19) infection.
  • HY-136266
    HCV-IN-29

    HCV Cancer
    HCV-IN-29 is a hepatitis C virus (HCV) inhibitor exacted from patent US8329159B2, compound 1e.
  • HY-116146
    CYM50179

    LPL Receptor Inflammation/Immunology
    CYM50179 (compound 22n) is a potent and selective S1P4-R (Sphingosine-1-phosphate4 receptor) agonist with an EC50 of 46 nM.
  • HY-10585B
    Valproic acid (sodium)(2:1)

    VPA (sodium)(2:1); 2-Propylpentanoic Acid (sodium)(2:1)

    HDAC Autophagy Mitophagy HIV Notch Apoptosis Endogenous Metabolite Cancer Infection Metabolic Disease Neurological Disease
    Valproic acid (VPA) sodium (2:1) is an orally active HDAC inhibitor, with IC50 in the range of 0.5 and 2 mM, also inhibits HDAC1 (IC50, 400 μM), and induces proteasomal degradation of HDAC2. Valproic acid sodium (2:1) activates Notch1 signaling and inhibits proliferation in small cell lung cancer (SCLC) cells. Valproic acid sodium (2:1) is used in the treatment of epilepsy, bipolar disorder, metabolic disease, HIV infection and prevention of migraine headaches.
  • HY-105231
    Bryostatin 1

    PKC HIV Cancer Infection Inflammation/Immunology Neurological Disease
    Bryostatin 1 is a natural macrolide isolated from the bryozoan Bugula neritina and is a potent and central nervous system (CNS)-permeable PKC modulator. Bryostatin 1 binds to the isolated C1 domain of Munc13-1 and the full-length Munc13-1 protein with Kis of 8.07 nM and 0.45 nM, respectively. Bryostatin 1 has anti-cancer, anti-inflammatory, neuroprotective, anti-HIV-1 infection properties.
  • HY-105099
    Rifalazil

    KRM-1648; ABI-1648

    DNA/RNA Synthesis Bacterial Infection Inflammation/Immunology
    Rifalazil (KRM-1648; ABI-1648), a rifamycin derivative, inhibits the bacterial DNA-dependent RNA polymerase and kills bacterial cells by blocking off the β-subunit in RNA polymerase. Rifalazil (KRM-1648; ABI-1648) is an antibiotic, exhibits high potency against mycobacteria, gram-positive bacteria, Helicobacter pyloriC. pneumoniae and C. trachomatis with MIC values from 0.00025 to 0.0025 μg/ml. Rifalazil (KRM-1648; ABI-1648) has the potential for the treatment of Chlamydia infection, Clostridium difficile associated diarrhea (CDAD), and tuberculosis (TB).
  • HY-150741
    ODN 2216

    Toll-like Receptor (TLR) IFNAR Interleukin Related Cancer Infection Inflammation/Immunology
    ODN 2216 is a TLR9 (toll-like receptor 9) ligand or agonist. ODN 2216 induces high amounts of IFN-α and IFN-β. ODN 2216 induces IFN-α by pDC (plasmacytoid DC) and IL-12 (p40) production by DC (dendritic cells). ODN 2216 stimulates IFN-γ production in peripheral blood mononuclear cells (PBMC), which is indirect and mediated by IFN-α/β. ODN 2216 can activate NK cells and promote IFN-γ production of TCR-triggered CD4 + T cells.
  • HY-131263
    Hydroxychloroquine Impurity F

    Others Others
    Hydroxychloroquine Impurity F is the impurity of Hydroxychloroquine. Hydroxychloroquine is a synthetic antimalarial agent which can also inhibit Toll-like receptor 7/9 (TLR7/9) signaling. Hydroxychloroquine is efficiently inhibits SARS-CoV-2 infection in vitro.
  • HY-131262
    Hydroxychloroquine Impurity E

    4-[(7-Chloro-4-quinolinyl)amino]-1-pentanol

    Others Others
    Hydroxychloroquine Impurity E is the impurity of Hydroxychloroquine. Hydroxychloroquine is a synthetic antimalarial agent which can also inhibit Toll-like receptor 7/9 (TLR7/9) signaling. Hydroxychloroquine is efficiently inhibits SARS-CoV-2 infection in vitro.
  • HY-Y1718S1
    Tridecanoic acid-d25

    N-Tridecanoic acid-d25

    Endogenous Metabolite Bacterial Cancer
    Tridecanoic acid-d25 is the deuterium labeled Tridecanoic acid. Tridecanoic acid (N-Tridecanoic acid), a 13-carbon medium-chain saturated fatty acid, can serve as an antipersister and antibiofilm agent that may be applied to research bacterial infections. Tridecanoic acid inhibits Escherichia coli persistence and biofilm formation.
  • HY-Y1718S
    Tridecanoic acid-d2

    N-Tridecanoic acid-d2

    Endogenous Metabolite Bacterial
    Tridecanoic acid-d2 is the deuterium labeled Tridecanoic acid. Tridecanoic acid (N-Tridecanoic acid), a 13-carbon medium-chain saturated fatty acid, can serve as an antipersister and antibiofilm agent that may be applied to research bacterial infections. Tridecanoic acid inhibits Escherichia coli persistence and biofilm formation.
  • HY-B0372A
    Bromhexine hydrochloride

    SARS-CoV Autophagy HIV Metabolic Disease
    Bromhexine hydrochloride is a potent and specific TMPRSS2 protease inhibitor with an IC50 of 0.75 μM. Bromhexine hydrochloride can prevent and manage SARS-CoV-2 infection. Bromhexine hydrochloride is an autophagy agonist. Bromhexine hydrochloride is a mucolytic cough suppressant and has the potential for a range of respiratory conditions.
  • HY-Y1718S2
    Tridecanoic acid-d9

    N-Tridecanoic acid-d9

    Endogenous Metabolite Bacterial
    Tridecanoic acid-d9 is the deuterium labeled Tridecanoic acid. Tridecanoic acid (N-Tridecanoic acid), a 13-carbon medium-chain saturated fatty acid, can serve as an antipersister and antibiofilm agent that may be applied to research bacterial infections. Tridecanoic acid inhibits Escherichia coli persistence and biofilm formation.
  • HY-143563
    NLRP3 antagonist 1

    NOD-like Receptor (NLR) Cancer
    NLRP3 antagonist 1 is a potent antagonist of NLRP3. NLRP3 is mainly expressed in macrophages and neutrophils and is involved in the body's intrinsic immunity against pathogenic infections and stress injury. NLRP3 antagonist 1 has the potential for the research of cancer disease (extracted from patent WO2021114691A1, compound 3).
  • HY-15034
    Indomethacin sodium

    Indometacin sodium

    COX Antibiotic Influenza Virus Cancer Inflammation/Immunology
    Indomethacin (Indometacin) sodium is a potent, orally active COX1/2 inhibitor with IC50 values of 18 nM and 26 nM for COX-1 and COX-2, respectively. Indomethacin sodium has anticancer activity and anti-infective activity. Indomethacin sodium can be used for cancer, inflammation and viral infection research..
  • HY-14397
    Indomethacin

    Indometacin

    COX Cancer Inflammation/Immunology
    Indomethacin (Indometacin) is a potent, orally active COX1/2 inhibitor with IC50 values of 18 nM and 26 nM for COX-1 and COX-2, respectively. Indomethacin has anticancer activity and anti-infective activity. Indomethacin can be used for cancer, inflammation and viral infection research.
  • HY-14397A
    Indomethacin sodium hydrate

    Indometacin sodium hydrate

    COX Bacterial Influenza Virus Cancer Inflammation/Immunology
    Indomethacin (Indometacin) sodium hydrateis a potent, orally active COX1/2 inhibitor with IC50 values of 18 nM and 26 nM for COX-1 and COX-2, respectively. Indomethacin sodium hydrateis has anticancer activity and anti-infective activity. Indomethacin sodium hydrateis can be used for cancer, inflammation and viral infection research.
  • HY-B0372AS
    Bromhexine-d3 hydrochloride

    SARS-CoV Autophagy HIV Metabolic Disease
    Bromhexine-d3 (hydrochloride) is deuterium labeled Bromhexine (hydrochloride). Bromhexine hydrochloride is a potent and specific TMPRSS2 protease inhibitor with an IC50 of 0.75 μM. Bromhexine hydrochloride can prevent and manage SARS-CoV-2 infection. Bromhexine hydrochloride is an autophagy agonist. Bromhexine hydrochloride is a mucolytic cough suppressant and has the potential for a range of respiratory conditions.
  • HY-B1030
    Lanatoside C

    Autophagy Enterovirus Cardiovascular Disease Cancer
    Lanatoside C is a cardiac glycoside, can be used in the treatment of congestive heart failure and cardiac arrhythmia.Lanatoside C has an IC50 of 0.19 μM for dengue virus infection in HuH-7 cells. Lanatoside C can effectively inhibit all four serotypes of dengue virus, flavivirus Kunjin, alphavirus Chikungunya, Sindbis virus and the human enterovirus 71.
  • HY-12725
    ML324

    Histone Demethylase HSV CMV Cancer
    ML324 is a potent JMJD2 demethylase inhibitor with antiviral activity. ML324 also exhibits inhibition for the histone demethylase KDM4B, with an IC50 of 4.9 μM. ML324 has potent anti-viral activity against both herpes simplex virus (HSV) and human cytomegalovirus (hCMV) infection via inhibition viral IE gene expression.
  • HY-117626
    LP-935509

    AAK1 Cyclin G-associated Kinase (GAK) SARS-CoV Infection Inflammation/Immunology Neurological Disease
    LP-935509 is an orally active, potent, selective, ATP-competitive and brain-penetrant inhibitor of adaptor protein-2 associated kinase 1 (AAK1) with an IC50 of 3.3 nM and a Ki of 0.9 nM, respectively. LP-935509 is also a potent inhibitor of BIKE (IC50=14 nM) and a modest inhibitor of GAK (IC50=320 nM). LP-935509 shows antinociceptive activity. LP-935509 can be used for neuropathic pain and SARS-CoV-2 research.
  • HY-135816
    CK2/PIM1-IN-1

    Casein Kinase Pim Cancer Inflammation/Immunology
    CK2/PIM1-IN-1 is an inhibitor of CK2 and PIM1, with IC50s of 3.787 μM and 4.327 μM for CK2 and PIM1, respectively. CK2/PIM1-IN-1 is developed for the research of proliferative disorders such as cancer, as well as other kinase-associated conditions including inflammation, pain, vascular disorders, pathogenic infections and certain immunological disorders.
  • HY-B1588S
    Carbenoxolone-d4

    Amyloid-β HIV Infection Inflammation/Immunology Neurological Disease
    Carbenoxolone-d4 is deuterium labeled Carbenoxolone. Carbenoxolone, a semi-synthetic derivative of glycyrrhetinic acid, has previously been used for the management of dyspepsia and peptic ulcer because of its anti-inflammatory properties. Carbenoxolone, a general hemichannel and gap junction inhibitor, has the therapeutic potential of carbenoxolone in the treatment of chronic liver disease. Carbenoxolone is a suitable candidate for the inhibition of Aβ42 aggregation and the therapeutic potential of Cbx against AD. Carbenoxolone is small molecule Pannexin1 (Panx1,is an ATP release channel) inhibitor, attenuate Panx1 channel activity through modulation of the first extracellular loop. Carbenoxolone is an 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1) inhibitor that converts inactive glucocorticoid into an active form. Carbenoxolone has antiviral activity against DENV infection targeting the virus itself.
  • HY-109509
    Enoxaparin

    PK 10169; Enoxaparin sodium; Lovenox

    Factor Xa Thrombin SARS-CoV Infection Inflammation/Immunology Neurological Disease Cardiovascular Disease
    Enoxaparin (PK 10169), a low-molecular-weight heparin (LMWH) derivative. Enoxaparin exerts anticoagulant activity through antithrombin III, an endogenous inhibitor of factor Xa and thrombin IIa. Enoxaparin protect the rat hippocampus against TBI (traumatic brain injury) via antioxidant and anti-inflammatory properties. Enoxaparin can be used for the research of deep vein thrombosis (DVT), pulmonary embolism, TBI and COVID-19.
  • HY-108391
    C8-Ceramide

    N-Octanoyl-D-erythro-sphingosine

    Apoptosis PKC Autophagy Cancer Inflammation/Immunology
    C8-Ceramide (N-Octanoyl-D-erythro-sphingosine) is a cell-permeable analog of naturally occurring ceramides. C8-Ceramide has anti-proliferation properties and acts as a potent chemotherapeutic agent. C8-Ceramide stimulates dendritic cells to promote T cell responses upon virus infections. C8-Ceramide induces slight activation of protein kinase (PKC) in vitro.
  • HY-B0180
    Imiquimod

    R 837

    Toll-like Receptor (TLR) Autophagy SARS-CoV HSV Cancer Infection Inflammation/Immunology
    Imiquimod (R 837), an immune response modifier, is a selective toll like receptor 7 (TLR7) agonist. Imiquimod exhibits antiviral and antitumor effects in vivo. Imiquimod can be used for the research of external genital, perianal warts, cancer and COVID-19.
  • HY-B0180A
    Imiquimod hydrochloride

    R 837 hydrochloride

    Toll-like Receptor (TLR) Autophagy SARS-CoV HSV Cancer Infection Inflammation/Immunology
    Imiquimod hydrochloride (R 837 hydrochloride), an immune response modifier, is a selective toll like receptor 7 (TLR7) agonist. Imiquimod hydrochloride exhibits antiviral and antitumor effects in vivo. Imiquimod hydrochloride can be used for the research of external genital, perianal warts, cancer and COVID-19.
  • HY-B0180B
    Imiquimod maleate

    R 837 maleate

    Toll-like Receptor (TLR) Autophagy SARS-CoV HSV Cancer Infection Inflammation/Immunology
    Imiquimod maleate (R 837 maleate), an immune response modifier, is a selective toll like receptor 7 (TLR7) agonist. Imiquimod maleate exhibits antiviral and antitumor effects in vivo. Imiquimod maleate can be used for the research of external genital, perianal warts, cancer and COVID-19.
  • HY-14648S3
    Dexamethasone-4,6α,21,21-d4

    Glucocorticoid Receptor SARS-CoV Autophagy Complement System Mitophagy Bacterial Antibiotic
    Dexamethasone-4,6α,21,21-d4 is the deuterium labeled Dexamethasone-4,6α,21,21. Dexamethasone (Hexadecadrol) is a glucocorticoid receptor agonist. Dexamethasone also significantly decreases CD11b, CD18, and CD62L expression on neutrophils, and CD11b and CD18 expression on monocytes. Dexamethasone is highly effective in the control of COVID-19 infection. Dexamethasone inhibits production of exosomes containing inflammatory microRNA-155 in lipopolysaccharide-induced macrophage inflammatory responses.
  • HY-119312
    C8 Dihydroceramide

    Others Cancer
    C8 Dihydroceramide is a negative control of C8 Ceramide. C8-Ceramide (N-Octanoyl-D-erythro-sphingosine) is a cell-permeable analog of naturally occurring ceramides. C8-Ceramide has anti-proliferation properties and acts as a potent chemotherapeutic agent. C8-Ceramide stimulates dendritic cells to promote T cell responses upon virus infections. C8-Ceramide induces slight activation of protein kinase (PKC) in vitro.
  • HY-17412A
    Minocycline

    Antibiotic Bacterial HIF/HIF Prolyl-Hydroxylase Apoptosis MDM-2/p53 Potassium Channel Calcium Channel Cancer Infection Metabolic Disease Inflammation/Immunology Neurological Disease Cardiovascular Disease
    Minocycline is an orally active, potent and BBB-penetrated semi-synthetic tetracycline antibiotic. Minocycline is a hypoxia-inducible factor (HIF)-1α inhibitor. Minocycline shows anti-cancer, anti-inflammatory, and glutamate antagonist effects. Minocycline reduces glutamate neurotransmission and shows neuroprotective properties and antidepressant effects. Minocycline inhibits bacterial protein synthesis through binding with the 30S subunit of the bacterial ribosome, resulting in a bacteriostatic effect.
  • HY-17412
    Minocycline hydrochloride

    Bacterial Antibiotic HIF/HIF Prolyl-Hydroxylase Apoptosis MDM-2/p53 Potassium Channel Calcium Channel Cancer Infection Metabolic Disease Inflammation/Immunology Neurological Disease Cardiovascular Disease
    Minocycline hydrochloride is an orally active, potent and BBB-penetrated semi-synthetic tetracycline antibiotic. Minocycline hydrochloride is a hypoxia-inducible factor (HIF)-1α inhibitor. Minocycline hydrochloride shows anti-cancer, anti-inflammatory, and glutamate antagonist effects. Minocycline hydrochloride reduces glutamate neurotransmission and shows neuroprotective properties and antidepressant effects. Minocycline hydrochloride inhibits bacterial protein synthesis through binding with the 30S subunit of the bacterial ribosome, resulting in a bacteriostatic effect.
  • HY-W010243S
    Methylisothiazolinone-d3 hydrochloride

    Bacterial Infection
    Methylisothiazolinone-d3 (hydrochloride) is the deuterium labeled Methylisothiazolinone (hydrochloride). Methylisothiazolinone hydrochloride is the constituent of the biocide Kathon CG. Methylisothiazolinone hydrochloride is an isothiazolone derivative widely used as a preservative. Methylisothiazolinone hydrochloride is also a moderate sensitizer and reacts with GSH.
  • HY-144341
    DprE1-IN-1

    Bacterial Infection
    DprE1-IN-1 is a potent, orally active DprE1 inhibitor with favorable hepatocyte stability, low cytotoxicity and low hERG channel inhibition. DprE1-IN-1 displays potent activity against both drug-susceptible and clinically isolated drug-resistant Tuberculosis strains with MICs<0.1 μg/mL, as well as good intracellular antimycobacterial activity with a 1.29 log10 CFU reduction in macrophages.
  • HY-147878
    Antibacterial agent 111

    Bacterial Infection
    Antibacterial agent 111 (Compound 3) is an antibacterial agent with MIC values of 3.90 μg/mL and 0.49 μg/mL against B. cereus and K. pneumonia, respectively. Antibacterial agent 111 firmly binds with tyrosyl-tRNA synthetase residues.
  • HY-139987A
    LeuRS-IN-1 hydrochloride

    Bacterial Infection
    LeuRS-IN-1 hydrochloride is a potent, orally active M. tuberculosis leucyl-tRNA synthetase (M.tb LeuRS) inhibitor. LeuRS-IN-1 hydrochloride has IC50 and Kd values of 0.06 μM, 0.075 μM for M.tb LeuRS, respectively. LeuRS-IN-1 hydrochloride inhibits human cytoplasmic LeuRS (IC50=38.8 μM), and HepG2 protein synthesis (EC50=19.6 μM).
  • HY-B1174
    Bekanamycin

    Kanamycin B

    Bacterial Antibiotic Infection
    Bekanamycin (Kanamycin B) is an aminoglycoside antibiotic produced by Streptomyces kanamyceticus, against an array of Gram-positive and Gram-negative bacterial strain.
  • HY-144260
    3CPLro-IN-1

    SARS-CoV Infection
    3CPLro-IN-1 (compound A17) is a potent and orally active inhibitor of SARS-CoV-2 3CLpro with an IC50 of 5.65 μM. 3-Chymotrypsin-like cysteine protease (3CLpro) is an indispensable protein in viral replication and represents an attractive drug target for fighting COVID-19.
  • HY-112853
    Fosmidomycin sodium salt

    FR-31564

    Bacterial Antibiotic Infection
    Fosmidomycin sodium salt is a phosphonic acid antibiotic and a antimalarial drug, which is active against both Gram-negative and Gram-positive bacteria.
  • HY-B0396
    Tebipenem pivoxil

    L084

    Bacterial Antibiotic Infection
    Tebipenem pivoxil (L084) is an orally active antibiotic against a variety of pathogenic bacteria. Tebipenem pivoxil binds penicillin-binding protein (PBP), thereby inhibiting cell wall synthesis.
  • HY-145274
    EB-0156

    Glucosidase Infection
    EB-0156 is a potent inhibitor of ER α-glucosidases (α-Glu) Iand II with IC50s of 0.0479 and less than 0.001 μM, respectively. EB-0156 is a N-substituted derivative of valiolamine with broad-spectrum antiviral. EB-0156 has the potential for the reseach of broad-spectrum agent against the existing and emerging viruses.
  • HY-132928
    Antitubercular agent-10

    Bacterial Infection
    Antitubercular agent-10 shows potent antitubercular activity with a MIC value of 30 nM.
  • HY-151269A
    SARS-CoV-2-IN-23 disodium

    SARS-CoV Infection
    SARS-CoV-2-IN-23 disodium is a two-armed diphosphate ester and medium length molecular tweezers. SARS-CoV-2-IN-23 disodium exhibits antiviral activity with IC50s of 8.2 μM and 2.6 μM against SARS-CoV-2 activity and the spike pseudoparticle transduction, respectively. SARS-CoV-2-IN-23 disodium induces liposomal membrane disruption with an EC50 value of 4.4 μM.
  • HY-101188
    INCB38579

    Histamine Receptor Infection
    INCB38579 is an orally active, highly brain penetrable, and selective histamine H4 receptor (HH4R) antagonist (hH4R IC50=4.8 nM, mH4R IC50=42 nM, rH4R IC50=32 nM). INCB38579 shows anti-inflammatory pain and anti-pruritic activities.
  • HY-I0726
    Enantiomer of Sofosbuvir

    Others Infection
    Enantiomer of Sofosbuvir is an enantiomer of Sofosbuvir, a prescription medicine for the treatment of patients with chronic hepatitis C. There is no biological activity report on enantiomer of Sofosbuvir until now.
  • HY-100436
    Cadazolid

    ACT-179811

    Bacterial Antibiotic Infection
    Cadazolid (ACT-179811) is a new oxazolidinone antibiotic with potent activity against Clostridium difficile.
  • HY-150062
    SARS-CoV-2 nsp3-IN-1

    SARS-CoV Infection
    SARS-CoV-2 nsp3-IN-1 (Compound 15c) is a Mac1 (SARS-CoV-2 nsp3 macrodomain) inhibitor with the IC50 value of 6.1 μM. SARS-CoV-2 nsp3-IN-1 can inhibit Mac1 ADP-ribosylhydrolase activity. SARS-CoV-2 nsp3-IN-1 demonstrates notable selectivity for coronavirus macrodomains, especially towards SARS-CoV-2 Mac1.
  • HY-111643
    6-Amino-5-azacytidine

    Bacterial Infection
    6-Amino-5-azacytidine inhibits the growth of bacteria E. coli.
  • HY-N6952
    Geraniol

    Fungal Endogenous Metabolite Infection
    Geraniol, an olefinic terpene, was found to inhibit growth of Candida albicans and Saccharomyces cerevisiae strains.
  • HY-16980
    Eravacycline

    TP-434

    Bacterial Infection
    Eravacycline is a potent and broad-spectrum antibacterial agent.
  • HY-130836
    LpxH-IN-AZ1

    Bacterial Infection
    LpxH-IN-AZ1, a sulfonyl piperazine compound, is a potent UDP-2,3-diacylglucosamine pyrophosphate hydrolase LpxH inhibitor. LpxH-IN-AZ1 is a potent inhibitor of Klebsiella pneumoniae LpxH with IC50 of 0.36 μM .
  • HY-118651
    Griseoluteic acid

    Bacterial Infection
    Griseoluteic acid, a phenazine antibiotic, is originally isolated from S. griseoluteus. Griseoluteic acid is a breakdown product of griseolutein A and B.
  • HY-144320
    HBV-IN-17

    HBV Infection
    HBV-IN-17 (compound 8) is a potent HBV capsid assembly modulator with an EC50 of 511 nM.
  • HY-146591
    Antibacterial agent 87

    Bacterial Infection
    Antibacterial agent 87 (Compound 4h) is a potent antibacterial agent with MIC values of 0.125, 0.0625 and 0.0625 μg/mL against MRSA, MRSE and S. aureus, respectively.
  • HY-146699
    MtTMPK-IN-5

    Bacterial Thymidylate Synthase Infection
    MtTMPK-IN-5 (compound 17) is a potent M. tuberculosis thymidylate kinase (MtbTMPK) inhibitor with an IC50 value of 34 μM. MtTMPK-IN-5 combines favorable enzyme inhibitory activity with significant activity against M. tuberculosis (MIC = 12.5 μM). MtTMPK-IN-5 can be used for researching tuberculosis.
  • HY-W009350
    Diazolidinyl urea

    Bacterial Infection
    Diazolidinyl urea, a broad spectrum preservative, is a formaldehyde-releasing compound that releases formaldehyde through its decomposition. Diazolidinyl urea is effective against most contaminating microorganisms, especially Pseudomonas.
  • HY-128554S
    N-Desethyl amodiaquine-d5

    Parasite Infection
    N-Desethyl amodiaquine-d5 is the deuterium labeled N-Desethyl amodiaquine. N-Desethyl amodiaquine is the major biologically active metabolite of Amodiaquine. N-Desethyl amodiaquine is an antiparasitic agent. IC50 values for strains V1/S and 3D7 are 97 nM and 25 nM, respectively.
  • HY-115900
    Tuberculosis inhibitor 4

    Bacterial Infection
    Tuberculosis inhibitor 4 (compound 16), a mandelic acid-based spirothiazolidinone, has potent antimycobacterial activity against Mycobacterium tuberculosis strain H37Rv with the high inhibition value 98% at lower than 6.25 µg/mL concentration.
  • HY-19364
    Ferroquine

    Ferrochloroquine; SSR97193

    Parasite Infection
    Ferroquine (Ferrochloroquine), a ferrocenyl analogue of Chloroquine, is an antimalarial agent. Ferroquine shows parasiticidal effect on Plasmodium by inducing oxidative stress and the subsequent destruction of the membrane.
  • HY-135842
    Aspoxicillin

    Bacterial Infection
    Aspoxicillin is a broad-spectrum antimicrobial agent against 68 isolates of Actinobacillus pleuropneumoniae with an MIC90 value of <= 0.05 μg/ml. Aspoxicillin has a long half-life in mouse serum of 55 minutes.
  • HY-N0097S2
    Guanosine-8-d-2

    HSV Endogenous Metabolite Infection
    Guanosine-8-d-2 is the deuterium labeled Guanosine. Guanosine (DL-Guanosine) is a purine nucleoside comprising guanine attached to a ribose (ribofuranose) ring via a β-N9-glycosidic bond. Guanosine possesses anti-HSV activ.
  • HY-B1454
    Clindamycin palmitate hydrochloride

    Bacterial Antibiotic Infection
    Clindamycin palmitate hydrochloride is a hydrochloride salt of the ester of clindamycin and palmitic acid and it is an antibacterial drug. Clindamycin palmitate hydrochloride is inactive in vitro, rapid in vivo hydrolysis converts this compound to the antibacterially active clindamycin.
  • HY-N7120
    Penicillin G Procaine

    PGP

    Bacterial Antibiotic Infection
    Penicillin G Procaine(PGP), a β-lactam antibiotic, is a crystalline complex produced by chemically combining penicillin G with procaine.
  • HY-17016S
    Oseltamivir-d5 phosphate

    GS 4104-d5

    Influenza Virus Infection
    Oseltamivir-d5 phosphate (GS 4104-d5) is the deuterium labeled Oseltamivir phosphate. Oseltamivir phosphate (GS 4104) is a neuraminidase inhibitor recommended for the treatment and prophylaxis of influenza A and B.
  • HY-19236
    PNU-103017

    HIV Protease HIV Infection
    PNU-103017 is an HIV protease inhibitor.
  • HY-119687
    Bifenazate

    GABA Receptor Infection
    Bifenazate is a carbazate acaricide that control 100% of mites at a concentration of 25 ppm. Bifenazate is a positive allosteric modulator of GABA receptor.
  • HY-10571A
    Delavirdine mesylate

    U 90152 mesylate; BHAP-U 90152 mesylate

    HIV Reverse Transcriptase Infection
    Delavirdine (U 90152) mesylate is a potent, highly specific and orally active non-nucleoside reverse transcriptase inhibitor (NNRTI). Delavirdine mesylate selectively inhibits HIV-1 reverse transcriptase (RT) (IC50=0.26 μM) over DNA polymerase α (IC50=440 μM) and polymerase δ (IC50>550 μM). Delavirdine mesylate is an inhibitor of HIV-1 replication and can can be used for the study of AIDs.
  • HY-B0330S2
    Levofloxacin-13C,d3

    (-)-Ofloxacin-13C,d3

    Bacterial Antibiotic Infection
    Levofloxacin-13C,d3 is the 13C- and deuterium labeled Levofloxacin.
  • HY-15236
    PSI-6206

    RO 2433; GS-331007

    HCV Infection
    PSI-6206 (RO 2433) is the deaminated derivative of PSI-6130, which is a potent and selective inhibitor of HCV NS5B polymerase. PSI-6206 low potently inhibits HCV replicon with EC90 of >100 μM.
  • HY-B0244
    Praziquantel

    Parasite Antibiotic Infection
    Praziquantel is a racemic mixture, which is composed of (R)-Praziquantel and (S)- Praziquantel. Praziquantel is safe and has been used for the research of schistosomiasis.
  • HY-A0148
    Halofantrine

    SKF-102886 free base; WR-171669

    Parasite Potassium Channel Infection
    Halofantrine (SKF-102886 free base) is a highly lipophilic antimalarial active against Chloroquine-resistant strains of Plasmodium falciparum. Halofantrine blocks HERG potassium channels.
  • HY-N3942
    Glabranine

    HIV Influenza Virus Infection
    Glabranine, an flavonoid, is isolated from Tephrosia s.p, exerts a inhibitory effect in vitro on the dengue virus. Glabranine forms interaction with the soluble ectodomain of DENV type 2 (DENV2) E protein.
  • HY-12820
    Sibofimloc

    Antibiotic-202

    Bacterial Antibiotic Infection
    Sibofimloc (Antibiotic-202) is a first-in-class, gut-restricted, orally active FimH adhesion inhibitor extracted from patent WO2014100158A1, Compound Example 202. Sibofimloc has anti-bacterial infective activity. Sibofimloc is developed for inflammatory bowel disease (IBD).
  • HY-131011
    Furanone C-30

    Bacterial Infection
    Furanone C-30 is a quorum sensing inhibitor. Furanone C-30 can effectively inhibit bacterial biofilm formation by S. mutans and its luxSmutant strain.
  • HY-W072009
    5,7-Dihydroxycoumarin

    Bacterial Infection
    5,7-Dihydroxycoumarin is a coumarin isolated from the inflorescences of Macaranga triloba. 5,7-Dihydroxycoumarin has antibacterial activities.
  • HY-14879C
    Avibactam sodium dihydrate

    NXL-104 dihydrate

    Bacterial Antibiotic Infection
    Avibactam sodium (NXL-104) dihydrate is a covalent and reversible non-β-lactam β-lactamase inhibitor which inhibits β-lactamase TEM-1 and CTX-M-15 with IC50s of 8 nM and 5 nM, respectively.
  • HY-B0508
    Ornidazole

    Ro 7-0207

    Bacterial Parasite Antibiotic Infection
    Ornidazole(Ro 7-0207) is a 5-nitroimidazole derivative with antiprotozoal and antibacterial properties against anaerobic bacteria.
  • HY-N4324
    cis-p-Menthan-1,8-diol

    4-p-Menthan-1,8-diol

    Others Infection
    cis-​p-​Menthan-​1,​8-​diol is a natural menthane monoterpenoid.
  • HY-107201
    β-Cyclodextrin

    Influenza Virus Infection
    β-Cyclodextrin is a cyclic polysaccharide composed of seven units of glucose (α-D-glucopyranose) linked by α-(1,4) type bonds. β-Cyclodextrin has often been used to enhance the solubility of drugs. β-Cyclodextrin has anti-influenza virus H1N1 activities.
  • HY-14818AS
    Laninamivir octanoate-d3

    CS-8958-d3

    Influenza Virus Infection
    Laninamivir octanoate-d3 (CS-8958-d3) is the deuterium labeled Laninamivir octanoate. Laninamivir octanoate (CS-8958), a prodrug of Laninamivir, is a long-acting neuraminidase (NA) inhibitor with anti-influenza virus activity. Laninamivir octanoate shows anti-influenza activity against Oseltamivir-resistant viruses, and also against the pandemic influenza viruses.
  • HY-W013699
    Chlorhexidine diacetate

    Bacterial Antibiotic Infection
    Chlorhexidine diacetate is a biguanide disinfectant with rapid bactericidal activity against both Gram-positive and Gram-negative organism. The antibacterial effect of chlorhexidine diacetate is related to its action on the bacterial cell membrane and to precipitation of intracellular contents.
  • HY-N7118
    Clindamycin hydrochloride monohydrate

    Bacterial Antibiotic Infection
    Clindamycin hydrochloride monohydrate is an oral protein synthesis inhibitory agent that has the ability to suppress the expression of virulence factors in Staphylococcus aureus at sub-inhibitory concentrations (sub-MICs). Clindamycin hydrochloride monohydrate resistance results from enzymatic methylation of the antibiotic binding site in the 50S ribosomal subunit (23S rRNA). Clindamycin hydrochloride monohydrate decreases the production of Panton-Valentine leucocidin (PVL), toxic-shock-staphylococcal toxin (TSST-1) or alpha-haemolysin (Hla).
  • HY-128554A
    N-Desethyl amodiaquine dihydrochloride

    Parasite Infection
    N-Desethyl amodiaquine dihydrochloride is the major biologically active metabolite of Amodiaquine. N-Desethyl amodiaquine dihydrochloride is an antiparasitic agent. IC50 values for strains V1/S and 3D7 are 97 nM and 25 nM, respectively.
  • HY-N2417
    Stearyl glycyrrhetinate

    Bacterial Infection
    Stearyl glycyrrhetinate, a major component in licorice extract, has a MIC against S. aureus strains of more than 256 mg/L. Stearyl glycyrrhetinate has antibacterial effects.
  • HY-116010
    Oleandomycin

    Bacterial Antibiotic Infection
    Oleandomycin is a macrolide antibiotic structurally closely related to Erythromycin. Oleandomycin is similar to Erythromycin with antimicrobial activity.
  • HY-109587B
    BM635 mesylate

    Bacterial Infection
    BM635 mesylate is a MmpL3 inhibitor with outstanding anti-mycobacterial activity. BM635 mesylate has a MIC50 of 0.6 μM against M. tuberculosis  H37Rv. BM635 mesylate significantly improves the bioavailability compared to free-base BM635.
  • HY-B0348
    Liranaftate

    Piritetrate; M-732

    Fungal Infection
    Liranaftate (Piritetrate) is a squalene epoxidase inhibitor with anti-fungicidal activities. Liranaftate can be used for the research of dermatophytes. Liranaftate also suppresses fungal element-promoted production of IL-8 and experimental inflammation.
  • HY-145114
    Iodobananin

    SARS-CoV Infection
    Iodobananin is an effective inhibitor of the ATPase activity of the SARS Coronavirus helicase with an IC50 value of 0.54 μM.
  • HY-128917
    DNA31

    DNA/RNA Synthesis Infection
    DNA31 is a potent RNA polymerase inhibitor.
  • HY-10468
    NM107

    2'-C-Methylcytidine; NM-107

    HCV Infection
    NM107 (2'-C-Methylcytidine) is an nucleoside inhibitor of the hepatitis C virus (HCV) NS5B polymerase, the EC50 of NM107 in the wild-type replicon cells is 1.85 μM.
  • HY-B0712A
    Ceftriaxone sodium hydrate

    Ceftriaxone disodium hemiheptahydrate

    Bacterial Antibiotic Infection
    Ceftriaxone sodium hydrate (Ceftriaxone disodium hemiheptahydrate) is a third-generation cephalosporin antibiotic with excellent activity against many gram-negative, and reasonable activity against most gram-positive microorganisms. Anti-inflammatory and antioxidant characteristics.
  • HY-121144
    Cefazedone

    Refosporen

    Bacterial Antibiotic Infection
    Cefazedone (Refosporen), a first-generation cephalosporin, is a time-dependent antibiotic with activity against Gram-positive and Gram-negative bacteria.
  • HY-N3075
    Phytol

    (E)​-​Phytol

    Parasite Bacterial Infection
    Phytol ((E)​-​Phytol), a diterpene alcohol from chlorophyll widely used as a food additive and in medicinal fields, possesses promising antischistosomal properties. Phytol has antinociceptive and antioxidant activitiesas well as anti-inflammatory and antiallergic effects. Phytol has antimicrobial activity against Mycobacterium tuberculosis and Staphylococcus aureus.
  • HY-151354
    Antibacterial agent 121

    Bacterial Infection
    Antibacterial agent 121 (Compound 10) is an antibacterial agent. Antibacterial agent 121 shows anti-mycobacterial and anti-inflammatory activities and can be used in Tuberculosis (TB) research.
  • HY-139582
    Simpinicline

    OC-02

    nAChR SARS-CoV Infection
    Simpinicline (OC-02), a highly selective nicotinic acetylcholine receptor (nAChR) agonist, shows potent antiviral activity against the SARS-CoV-2 variants in cell culture with an IC50 of 0.04 µM.
  • HY-B0937
    Amprolium

    Parasite Infection
    Amprolium is a coccidiostat used in poultry, is a thiamine analogue and blocks the thiamine transporter of Eimeria species by blocking thiamine uptake it prevents carbohydrate synthesis.
  • HY-18748
    BQR-695

    NVP-BQR695

    PI4K Parasite Infection
    BQR-695 is a PI4KIIIβ inhibitor with IC50s of 80 and 3.5 nM for human PI4KIIIβ and Plasmodium variant of PI4KIIIβ, respectively.
  • HY-W010986
    Fmoc-N-Me-Phe-OH

    Parasite Infection
    Fmoc-N-Me-Phe-OH is a peptide inhibitor of Malaria Parasite.
  • HY-N0216S1
    Benzoic acid-13C6

    Bacterial Fungal Endogenous Metabolite Infection
    Benzoic acid-13C6 is the 13C-labeled Benzoic acid. Benzoic acid is an aromatic alcohol existing naturally in many plants and is a common additive to food, drinks, cosmetics and other products. It acts as preservatives through inhibiting both bacteria and fungi.
  • HY-107373
    β-Chloro-L-alanine

    L-β-Chloroalanine

    Bacterial Infection
    β-Chloro-L-alanine is a bacteriostatic amino acid analog which inhibits a number of enzymes, including threonine deaminase and alanine racemase.
  • HY-N9179
    3′,4′,5′,5,6,7-Hexamethoxyflavone

    Parasite Infection
    3′,4′,5′,5,6,7-Hexamethoxyflavone is a flavonoid with antiprotozoal activity. 3′,4′,5′,5,6,7-Hexamethoxyflavone inhibits trypanosoma bruceirhodesiense with IC50 of 21.3 μM (8.58 g/mL).
  • HY-133004
    Fenbutatin oxide

    Parasite Infection
    Fenbutatin oxide is an organotin acaricide.
  • HY-N9194
    5-Methoxycanthin-6-one

    Others Infection
    5-Methoxycanthin-6-one is an orally active inhibitor of Leishmania strains. 5-Methoxycanthin-6-one shows cytotoxicity with an IC50 of 5.44 μg/mL against Ailanthus altissima cells.
  • HY-19581S
    Baquiloprim-d6

    Antibiotic Bacterial Infection
    Baquiloprim-d6 is deuterium labeled Baquiloprim. Baquiloprim, an antibiotic, is a selective inhibitor of bacterial dihydrofolate reductases. Baquiloprim possesses in vitro bacteriostatic activity against both Gram-negative and Gram-positive bacteria.
  • HY-B1781S
    Sulfachloropyridazine-13C6

    Sulfachlorpyridazine-13C6

    Bacterial Antibiotic Infection
    Sulfachloropyridazine-13C6 is the 13C6 labeled Sulfachloropyridazine. Sulfachloropyridazine is a broad spectrum sulfonamide used against both Gram-positive and Gram-negative aerobic bacteria.
  • HY-125666
    Agistatin B

    Others Infection
    Agistatin B, isolated from fungus, is a mycotoxin. Agistatin B inhibits cholesterol synthesis.
  • HY-B0330S1
    (S)-Ofloxacin-d3

    Bacterial Antibiotic Infection
    (S)-Ofloxacin-d3 is the deuterium labeled Levofloxacin. Levofloxacin, a synthetic fluoroquinolone, is an antibacterial agent that inhibits the supercoiling activity of bacterial DNA gyrase, halting DNA replication.
  • HY-W001957
    Glurate

    4-Acetylbutyric acid; 5-Oxohexanoic acid

    Others Infection
    Glurate (4-Acetylbutyric acid; 5-Oxohexanoic acid) can be used to construct antiviral agents (acyclic nucleoside esters) (extracted from patent WO1997030052A1).
  • HY-136330
    Oxazosulfyl

    Bacterial Infection
    Oxazosulfyl is a potent agricultural fungicide. Oxazosulfyl can be used as an insecticide against major rice pests.
  • HY-139654
    α/β-Hydrolase-IN-1

    Others Infection
    α/β-Hydrolase-IN-1 exhibits the best-in-class MICs of 50 μM (25 μg/mL) and 16 μM (8.4 μg/mL) against M. smegmatis and M. tuberculosis H37Ra, respectively.
  • HY-150600
    NS2B/NS3-IN-7

    Virus Protease Infection
    NS2B/NS3-IN-7 (compound 26) is a highly potent Zika virus NS2B-NS3 protease inhibitor with a Ki value of 2.33 nM. NS2B/NS3-IN-7 can reduce amounts of ZIKV-infected cells.
  • HY-10544
    Tegobuvir

    GS 333126; GS-9190

    HCV Infection
    Tegobuvir is a specific, covalent inhibitor of the HCV NS5B polymerase.
  • HY-B0945
    Nitromide

    3,5-Dinitrobenzamide

    Parasite Infection
    Nitromide is an anti-parasitic agent.
  • HY-N10293
    Monaschromone

    Fungal Endogenous Metabolite Infection
    Monaschromone, a polyketide metabolite, significantly inhibits the growth of B. cinerea, A. solani, M. oryzae, and G. saubinettii, with the MIC values ranging from 6.25 to 12.5 μM.
  • HY-14818S
    Laninamivir-d3

    Influenza Virus Infection
    Laninamivir-d3 (R 125489-d3) is the deuterium labeled Laninamivir. Laninamivir (R 125489) is a potent influenza neuraminidase (NA) inhibitor with IC50s of 0.90 nM, 1.83 nM and 3.12 nM for avian H12N5 NA (N5), pH1N1 N1 NA (p09N1) and A/RI/5+/1957 H2N2 N2 (p57N2), respectively.
  • HY-143749
    Cap-dependent endonuclease-IN-6

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-6 (compound 13) is a cap-dependent endonuclease (CEN) inhibitor. Cap-dependent endonuclease-IN-6 shows inhibition against influenza virus (EC50=38.21 nM).
  • HY-145081
    Pitnot-2

    Others Infection
    Pitnot-2 is an inactive analog of clathrin inhibitor Pitstop 2. Pitnot-2 can be used as negative control.
  • HY-70083
    SPK-601

    LMV-601

    Phospholipase Reverse Transcriptase Infection
    SPK-601 (LMV-601) is an inhibitor of the phosphatidylcholine-specific phospholipase C (PC-PLC). SPK-601 also can be used as an antimicrobial agent.
  • HY-B0847
    Propiconazole

    Fungal Reactive Oxygen Species Infection
    Propiconazole is a broad-spectrum triazole fungicide that inhibits the conversion of lanosterol to ergosterol, leading to fungal cell membrane disruption. Propiconazole inhibits S. cerevisiae, but not rat liver, microsomal cytochrome P450 (IC50s=0.04 and >200 µM, respectively). Propiconazole inhibits the growth of T. deformans and R. stolonifer (ED50s=0.073 and 4.6 µg/mL, respectively). Propiconazole increases production of reactive oxygen species (ROS).
  • HY-129208
    Viridicatumtoxin

    Antibiotic Fungal Infection
    Viridicatumtoxin is a new mycotoxin extracted from Penicillium viridicatum with a LD50 of 122.4 mg/kg in rats.
  • HY-N3353
    Luteone

    Bacterial Fungal Infection
    Luteone is a natural isoflavone, with antioxidant, antibacterial and antifung activities.
  • HY-146427
    Antifungal agent 29

    Fungal Infection
    Antifungal agent 29 (compound 9d) is a potent, selective and non-toxic antifungal agent. Antifungal agent 29 shows antifungal activity towards Cryptococcus neoformans (MIC ≤ 0.23 μM).
  • HY-138671
    DprE1-IN-4

    Bacterial Infection
    DprE1-IN-4 is a potent and orally active noncovalent DprE1 inhibitor with an IC50 of 0.90 μg/mL. DprE1-IN-4 exhibits potent in vitro activity against M. tuberculosis H37Rv and drug-resistant tuberculosis strain with MIC values of 0.12 μg/mL and 0.24 μg/mL, respectively. DprE1-IN-4 displays acceptable pharmacokinetic property and shows significant bactericidal activity in an acute mouse model of tuberculosis.
  • HY-142467
    HIV-1 inhibitor-11

    HIV Infection
    HIV-1 inhibitor-11, a fused pyridine ring derivative, is a HIV-1 inhibitor. WO2021104413A1 ( compound 1-1b).
  • HY-146271
    pUL89 Endonuclease-IN-2

    CMV Infection
    pUL89 Endonuclease-IN-2 (Compound 15k) is a potent inhibitor of human cytomegalovirus (HCMV) pUL89 endonuclease with the IC50 of 3.0 μM. Antiviral activities.
  • HY-143775
    Cap-dependent endonuclease-IN-20

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-20 is a cap-dependent endonuclease (CEN) inhibitor. Cap-dependent endonuclease-IN-20 shows antiviral activity against influenza virus A/Hanfang/359/95 (H3N2) with IC50 of 4.82 μM (CN112940009A; DSC801).
  • HY-113629
    2-Keto-D-Glucose

    D-Glucosone; D-Arabino-hexos-2-ulose

    Others Infection
    2-Keto-D-Glucose (D-Glucosone) is a key intermediate in a secondary metabolic pathway leading to the antibiotic Cortalcerone. 2-Keto-D-Glucose is also an intermediate in the conversion of D-glucose into D-fructose. 2-Keto-D-Glucose is found in various natural sources, including fungi, algae, and shellfish.
  • HY-N6681
    15-Acetoxyscirpenol

    Caspase Bacterial Apoptosis Antibiotic Infection
    15-acetoxyscirpenol, one of acetoxyscirpenol moiety mycotoxins (ASMs), strongly induces apoptosis and inhibits Jurkat T cell growth in a dose-dependent manner by activating other caspases independent of caspase-3.
  • HY-136450S1
    Triclabendazole sulfoxide-13C,d3

    TCBZ-SO-13C,d3

    Parasite BCRP Infection
    Triclabendazole sulfoxide-13C,d3 is the 13C- and deuterium labeled Triclabendazole sulfoxide. Triclabendazole sulfoxide (TCBZ-SO) is the main plasma metabolite of Triclabendazole, and exhibits anti-parasite effects. Triclabendazole sulfoxide can inhibit membrane transporter ABCG2/BCRP.
  • HY-B0852
    Tebuconazole

    Cytochrome P450 Fungal Infection
    Tebuconazole is an agricultural azole fungicide which can also inhibit CYP51 with IC50s of 0.9 and 1.3 μM for Candida albicans CYP51 (CaCYP51) and truncated Homo sapiens CYP51 (Δ60HsCYP51), respectively.
  • HY-146264
    Antibacterial agent 91

    Aminoacyl-tRNA Synthetase Bacterial Infection
    Antibacterial agent 91 (Compound 36b) is a triple-site aminoacyl-tRNA synthetase (aaRS) inhibitor with an IC50 of 2.10 μM against Salmonella enterica threonyl-tRNA synthetase (SeThrRS). Antibacterial agent 91 exhibits antibacterial activities.
  • HY-145431
    BPTF-IN-1

    Epigenetic Reader Domain Parasite Infection
    BPTF-IN-1 (compound AU1) is a selective bromodomain and PHD finger containing transcription factor (BPTF) bromodomain inhibitor with a Kd of 2.8 μM. BPTF-IN-1 shows to be selective for BPTF over BRD4 bromodomain. BPTF-IN-1 shows antimalarial activity.
  • HY-D0186S3
    2'-Deoxyuridine-5′-13C

    Endogenous Metabolite Infection
    2'-Deoxyuridine-5′-13C is the 13C labeled 2'-Deoxyuridine. 2'-Deoxyuridine could increase chromosome breakage and results in a decreased thymidylate synthetase activity. A known use of 2'-Deoxyuridine is as a precursor in the synthesis of Edoxud[1]
  • HY-B1434
    7-Aminocephalosporanic acid

    7-ACA

    Bacterial Antibiotic Infection
    7-Aminocephalosporanic acid is the core chemical structure for the synthesis of cephalosporin antibiotics, is a potent β-lactamase inhibitor.
  • HY-B0947
    Sulfanitran

    Bacterial Infection
    Sulfanitran is an antibacterial and anticoccidial agent used in poultry feeds. Sulfanitran also is a multidrug resistance protein 2 (MRP2) stimulator that can increase the affinity of MRP2 for estradiol-17-β-D-glucuronide (E217βG).
  • HY-W011117
    Danofloxacin

    Bacterial DNA/RNA Synthesis Antibiotic Infection
    Danofloxacin is a third generation fluoroquinolone and orally active antimicrobial agent. Danofloxacin shows a broad spectrum of activity against most Gram-negative and Gram-positive bacteria, mycoplasma and chlamydia species, and plays an antimicrobial role by inhibition of bacterial DNA-gyrase. Danofloxacinh has the potential for respiratory diseases in cattle, swine, and chickens treatment.
  • HY-15233
    Letermovir

    AIC246

    CMV Infection
    Letermovir (AIC246) is a potent inhibitor of CMV, which targets the viral terminase complex and remains active against virus resistant to DNA polymerase inhibitors.
  • HY-111023
    Nemonoxacin malate

    TG-873870 malate

    Antibiotic Bacterial Infection
    Nemonoxacin (TG-873870) malate is a nonfluorinated quinolone antibiotic. Nemonoxacin malate has broad-spectrum activity against Gram-positive, Gram-negative and atypical pathogens. Nemonoxacin malate can inhibit drug-resistant Streptococcus pneumoniae and (HY-121544) Methicillin-resistant Staphylococcus aureus. Nemonoxacin malate can be used for the research of community-acquired pneumonia.
  • HY-13832S1
    Atovaquone (4-chlorophenyl-2,3,5,6-d4)

    Parasite Cytochrome P450 Antibiotic Infection
    Atovaquone (4-chlorophenyl-2,3,5,6-d4) is the deuterium labeled Atovaquone. Atovaquone is a potent, selective and orally active inhibitor of the parasite’s mitochondrial cytochrome bc1 complex. Atovaquone is against human and  P. falciparum cytochrome bc1 activity with IC50 values of 460 nM and 2.0 nM, respectively. Atovaquone is an antimalarial agent and has the potential for the investigation of neumocystis pneumonia, toxoplasmosis, malaria, and babesia.
  • HY-143643
    Antibacterial agent 72

    Bacterial Infection
    Antibacterial agent 72 displays the antibacterial activities by targeting the bacterial membrane.
  • HY-146503
    Antibacterial agent 86

    Others Infection
    Antibacterial agent 86 (Compound A11) is the most active and displays bacteriostatic activities against methicillin-resistant S. aureus, with MIC values as low as 0.00191 μg/mL, which is 162 and 32 times lower than that of the marketed antibiotics tiamulin and retapamulin, respectively.
  • HY-142009
    Antiviral agent 10

    RSV Infection
    Antiviral agent 10 is an anti-viral agent that can inhibit respiratory syncytial virus (RSV).
  • HY-B2008
    Famoxadone

    DPX-JE874

    Fungal Infection
    Famoxadone (DPX-JE874) is a fungicide acting against a broad spectrum of fungi and is widely used in Integrated Pest Management strategies in different agricultural crops.
  • HY-145348
    MK-5204

    Others Infection
    MK-5204 is an orally active β-1,3-glucan synthesis inhibitor.
  • HY-B1340S
    Carbadox-d3

    Bacterial Antibiotic Endogenous Metabolite Infection
    Carbadox-d3 is the deuterium labeled Carbadox. Carbadox is a quinoxaline-di-N-oxide antibiotic compound which is widely fed to nursery-age pigs to control enteric diseases and improve feed efficiency.
  • HY-146338
    RPR103611

    HIV Infection
    RPR103611, the betulinic acid derivative, is a potent HIV-1 entry inhibitor with IC50s of 80, 0.27, and 0.17 for CCR5-tropic virus YU2, CXCR4-tropic virus NL4-3 and dual tropic virus 89.6, respectively.
  • HY-151274
    SARS-CoV-2-IN-28

    SARS-CoV Infection
    SARS-CoV-2-IN-28 is a two-armed diphosphate ester with C7 alkyl and molecular tweezers with extended length. SARS-CoV-2-IN-28 exhibits antiviral activity with IC50s of 0.4 μM and 1.0 μM against SARS-CoV-2 activity and the spike pseudoparticle transduction, respectively. SARS-CoV-2-IN-28 induces liposomal membrane disruption with an EC50 value of 4.4 μM.
  • HY-W020777
    Triflumizole

    Fungal Infection
    Triflumizole is one of imidazole fungicides that works by inhibiting ergosterol biosynthesis, and is widely used for the control of powdery mildew and scabs on various fruits and crops.
  • HY-139905
    Antifungal agent 19

    Fungal Infection
    Antifungal agent 19 shows the potent antifungal activity (EC50 = 0.72 μM).
  • HY-137335
    6'-Sialyllactose sodium

    Bacterial Infection
    6'-Sialyllactose (sodium), a predominant milk oligosaccharide, reduces the internalisation of Pseudomonas aeruginosa in human pneumocytes.
  • HY-121075
    Alizarin complexone

    Reverse Transcriptase Infection
    Alizarin complexone is a calcium-tracer and a chelating agent. Alizarin complexone is Rous-associated virus 2 reverse transcriptase (RAV-2 RT) inhibitor.
  • HY-B1682S
    Loracarbef-d5

    Antibiotic Bacterial Infection
    Loracarbef-d5 is the deuterium labeled Loracarbef. Loracarbef, a cephalosporin antibiotic, is an orally active second-generation synthetic beta-lactam antibiotic of the carbacephem class.
  • HY-122470
    Stampidine

    Reverse Transcriptase HIV Infection
    Stampidine is a nucleoside reverse transcriptase inhibitor (NRTI) with potent and broad-spectrum anti-HIV activity. Stampidine inhibits the laboratory HIV-1 strain HTLVIIIB (B-envelope subtype) and primary clinical isolates with IC50s of 1 nM and 2 nM, respectively. Stampidine also inhibits NRTI-resistant primary clinical isolates and NNRTI-resistant clinical isolates with IC50s of 8.7 nM and 11.2 nM, respectively.
  • HY-136448
    SJ000025081

    Parasite Infection
    SJ000025081 is a dihydropyridine and acts as a potent antimalarial agent. SJ000025081 results in an obvious suppression of the parasitemia in a murine malaria model infected with P. yoelii.
  • HY-100306
    PNU-176798

    Bacterial Infection
    PNU-176798 is an antimicrobial agent, targeting protein synthesis in a wide spectrum of gram-positive and anaerobic bacteria.
  • HY-135221A
    Cefcapene pivoxil

    Antibiotic Infection
    Cefcapene pivoxil is an orally active cephalosporin antibiotic. It is a precursor agent that dissociates into free acid and then exerts antibacterial effect.
  • HY-B0334AS
    Sulbactam-d5 sodium

    Bacterial Antibiotic Infection
    Sulbactam-d5 sodium (CP45899-d5) sodium is the deuterium labeled Sulbactam sodium. Sulbactam (CP45899) sodium is a competitive, irreversible beta-lactamase inhibitor. Sulbactam sodium shows antimicrobial activity against multidrug-resistant (MDR) acinetobacter calcoaceticus--Acinetobacter baumannii (Acb) complex.
  • HY-146595
    FtsZ-IN-1

    Bacterial Infection
    FtsZ-IN-1 is a potent FtsZ inhibitor with quinolinium ring. FtsZ-IN-1 has stronger antibacterial activity against Gram-positive bacteria with MICs of 0.5-8 μg/mL. FtsZ-IN-1 significantly causes cell elongation of B. subtilis by enhancing FtsZ polymerization. FtsZ-IN-1 exhibits low hemolytic toxicity and low tendency to induce drug resistance. FtsZ-IN-1 has against drug-resistant bacteria activity.
  • HY-U00214
    Ibafloxacine

    R835; S25930

    Bacterial Infection
    Ibafloxacine (R835) is a fluoroquinolone antibiotic agent that is developed exclusively for veterinary use.
  • HY-N7048
    Nystatin A3

    Fungal Antibiotic Infection
    Nystatin A3, produced by Streptomyces noursei, a biologically active component of nystatin complex. Antibiotic activity
  • HY-17016
    Oseltamivir phosphate

    GS 4104

    Influenza Virus Infection
    Oseltamivir phosphate (GS 4104) is a neuraminidase inhibitor recommended for the treatment and prophylaxis of influenza A and B.
  • HY-N10288
    Eucalyptacid A

    Fungal Endogenous Metabolite Infection
    Eucalyptacid A, an antifungal metabolite, exhibits antifungal activities against Alternaria solani, with MIC values from 6.25 to 50 μM.
  • HY-B0322S
    Sulfamethoxazole-d4

    Ro 4-2130-d4

    Bacterial Antibiotic Infection
    Sulfamethoxazole D4 (Ro 4-2130 D4) is a deuterium labeled Sulfamethoxazole (Ro 4-2130). Sulfamethoxazole is a sulfonamide bacteriostatic antibiotic.
  • HY-12784AS1
    Cycloguanil-d6 hydrochloride

    Parasite Drug Metabolite Infection
    Cycloguanil-d6 hydrochloride is the deuterium labeled Cycloguanil hydrochloride. Cycloguanil hydrochloride, the active metabolite of Proguanil, acts on malaria schizonts in erythrocytes and hepatocytes.
  • HY-144123
    HIV-1 inhibitor-16

    HIV Infection
    HIV-1 inhibitor-16 (compound 7a) is a highly potent HIV-1 inhibitor with an EC50 value of 1.3 nM for HIV-1 WT. HIV-1 inhibitor-16 also has certain inhibitory activity against HIV-1 K103N, E138K, Y181C and L100I strains with EC50s of 5.4 nM, 9.2 nM, 22 nM and 35 nM. HIV-1 inhibitor-16 has favorable solubility and liver microsome stability, and does not exhibit apparent CYP enzymatic inhibitory activity or acute toxicity.
  • HY-17466
    Sancycline

    Bonomycin; 6-Demethyl-6-deoxytetracycline

    Bacterial Infection
    Sancycline is a rare semi-synthetic tetracycline prepared by hydrogenolysis of the chloro and benzylic hydroxy moieties of Declomycin.
  • HY-133685
    N-Hexanoyl-L-homoserine lactone

    Bacterial Infection
    N-Hexanoyl-L-homoserine lactone is a short-chained N-acyl homoserine lactone (AHL). Diatoms are frequently found in association with Proteobacteria, many members of which employ cell-to-cell communication via AHLs in aquatic habitats.
  • HY-141829
    Antibacterial agent 27

    Bacterial Infection
    Antibacterial agent 27 is a potent antibacterial compound against Candida species.
  • HY-N7041
    11-Oxomogroside IIa

    HSV Infection
    11-Oxomogroside IIa (11-oxomogroside II A1) is a cucurbitane glycoside extracted from the fruits of Siraitia grosVenorii. 11-Oxomogroside IIa has inhibitory effects against the Epstein-Barr virus early antigen (EBV-EA) activation induced by 12-O-tetradecanoylphorbol-13-acetate (TPA), shows weak inhibitory effects on activation of (+/-)-(E)-methyl-2-[(E)-hydroxyimino]-5-nitro-6-methoxy-3-hexemide (NOR 1), a nitric oxide (NO) donor.
  • HY-146769
    Antimalarial agent 11

    Parasite Infection
    Antimalarial agent 11 (compound 1), a spirocyclic chromane, is a potent antimalarial agent. Antimalarial agent 11 exhibits excellent potency with an EC50 of 350 nM against the Chloroquine-resistant Dd2 strain. Antimalarial agent 11 has EC50s of 1.48 µM and 1.81 µM against D6 and ARC08-022 strains, respectively.
  • HY-116872
    MAC13772

    Bacterial Infection
    MAC13772 is a potent inhibitor of the enzyme BioA (IC50=250 nM), the antepenultimate step in biotin biosynthesis. MAC13772 is a novel antibacterial compound.
  • HY-100289
    MF 5137

    Bacterial Infection
    MF 5137 is a potent antibacterial agent.
  • HY-150554
    Antitubercular agent-29

    Bacterial Infection
    Antitubercular agent-29 (compound 6xa) is a potent drug resistant (DR) Mycobacterium tuberculosis (Mtb) inhibitor with MIC of 0.03 µg/mL against drug-susceptible (DS)-Mtb strains, MIC of 0.03-0.06 µg/mL against DR-Mtb strains, and favourable selectivity (SI>40) against Vero cells.
  • HY-P1758
    IFN-α Receptor Recognition Peptide 1

    IRRP1

    IFNAR Infection
    IFN-α Receptor Recognition Peptide 1 is a peptide of IFN-α associated with receptor interactions.
  • HY-79635
    Methyl indole-3-carboxylate

    Bacterial Infection
    Methyl indole-3-carboxylate is a natural product isolated from Sorangium cellulosum strain Soce895. Methyl indole-3-carboxylate shows a weak activity against the Gram-positive Nocardia sp with a MIC value of 33.33 μg/mL.
  • HY-P0289
    CEF3

    Influenza Virus Infection
    CEF3 (SIIPSGPLK) corresponds to aa 13-21 of the influenza A virus M1 protein. The matrix (M1) protein of influenza A virus is a multifunctional protein that plays essential structural and functional roles in the virus life cycle.
  • HY-B1218
    Sulfaphenazole

    Bacterial Infection
    Sulfaphenazole is a specific inhibitor of CYP2C9 which blocks atherogenic and pro-inflammatory effects of linoleic acid (increase in oxidative stress and activation of AP-1) mediated by CYP2C9.
  • HY-B0810
    Pivmecillinam

    FL-1039

    Bacterial Antibiotic Infection
    Pivmecillinam (FL-1039) is an orally active prodrug of mecillinam, an extended-spectrum penicillin antibiotic.
  • HY-P0261B
    Indolicidin TFA

    Bacterial Infection
    Indolicidin TFA is a potent antimicrobial peptide purified from the cytoplasmic granules of bovine neutrophils.
  • HY-D0186S2
    2'-Deoxyuridine-3′-13C

    Endogenous Metabolite Infection
    2'-Deoxyuridine-3′-13C is the 13C labeled 2'-Deoxyuridine. 2'-Deoxyuridine could increase chromosome breakage and results in a decreased thymidylate synthetase activity. A known use of 2'-Deoxyuridine is as a precursor in the synthesis of Edoxud[1]
  • HY-B1858
    Isoprothiolane

    Fungal Infection
    Isoprothiolane is a systemic fungicide. Isoprothiolane is a rice blast controlling agent against the fungal disease of rice planty Pyvioutavia oryzae Cav.
  • HY-133651
    2,2-Dibromopropanoic acid

    Fungal Infection
    2,2-Dibromopropanoic acid is a dibromo product based on propionic acid. Propionic acid is a short chain fatty acid and acts as chemical intermediate. Propionic acid is also a mold inhibitor and widely used in food preservative.
  • HY-W098556
    4-Hydroxyhygric acid

    Others Infection
    4-Hydroxyhygric acid is a compound isolated from leaves of five species of the leguminous tropical tree Copuiferq. 4-Hydroxyhygric acid is the inhibitor of larval development of the seed-feeding bruchid beetle Callosobruchus maculatus and to have significant feeding deterrence of the leaf-feeding lepidopteran Spodoprera littoralis.
  • HY-123087
    N-(3-Hydroxytetradecanoyl)-DL-homoserine lactone

    N-(3-oxodecanoyl)-homoserine lactone

    Bacterial Infection
    N-(3-Hydroxytetradecanoyl)-DL-homoserine lactone (N-(3-oxodecanoyl)-homoserine lactone) is a member of N-Acyl homoserine lactone (AHL) from V. alginolyticus strains. N-(3-Hydroxytetradecanoyl)-DL-homoserine lactone is used for biofilm formation and has antibacterial activity.
  • HY-125617
    α-Lipomycin

    Antibiotic Bacterial Infection
    α-Lipomycin is an acyclic polyene antibiotic isolated from the gram-positive bacterium Streptomyces aureofaciens Tü117.
  • HY-107739
    Penciclovir sodium

    VSA 671 sodium; BRL 39123A; BRL 39123D

    HSV Infection
    Penciclovir (VSA 671) sodium is a potent and selective anti-herpesvirus agent with EC50 values of 0.5, 0.8 µg/ml for HSV-1 (HFEM), HSV-2 (MS), respectively. Penciclovir sodium shows anti-herpesvirus activity with no-toxic. Penciclovir sodium preventes mortality in mouse.
  • HY-B0852S
    Tebuconazole-d9

    Cytochrome P450 Fungal Infection
    Tebuconazole-d9 is the deuterium labeled Tebuconazole. Tebuconazole is an agricultural azole fungicide which can also inhibit CYP51 with IC50s of 0.9 and 1.3 μM for Candida albicans CYP51 (CaCYP51) and truncated Homo sapiens CYP51 (Δ60HsCYP51), respectively.
  • HY-138078
    Lufotrelvir

    PF-07304814

    SARS-CoV Infection
    Lufotrelvir (PF-07304814), a phosphate prodrug of PF-00835231, acts as a potent 3CL pro protease (M pro) inhibitor with SARS-CoV-2 antiviral activity. Lufotrelvir binds and inhibits SARS-CoV-2 3CL pro activity with a Ki of 174nM. Lufotrelvir is promising single antiviral agent and also can be used for the research of combination with other antivirals that target other critical stages of the coronavirus life cycle.
  • HY-Y0366S3
    Lauric acid-d3

    Endogenous Metabolite Bacterial Infection
    Lauric acid-d3 is the deuterium labeled Lauric acid. Lauric acid is a middle chain-free fatty acid with strong bactericidal properties. The EC50s for P. acnes, S.aureus, S. epidermidis, are 2, 6, 4 μg/mL, respectively.
  • HY-139663
    IHVR-17028

    Influenza Virus Glucosidase Infection
    IHVR-17028 is a potent and broad-spectrum antiviral agent. IHVR-17028 exhibits antiviral activity against BVDV, TCRV and DENV with EC50 values of 0.4 μM, 0.26 μM, 0.3 μM, respectively. IHVR-17028 is a potent ER α-glucosidase I inhibitor with an IC50 of 0.24 μM. IHVR-17028 can be used for infectious diseases research.
  • HY-19743
    Triazavirin

    Nucleoside Antimetabolite/Analog Influenza Virus DNA/RNA Synthesis Infection
    Triazavirin is a nucleoside analogue of nucleic acid and an antiviral agent. Triazavirin works by inhibiting the synthesis of viral RNA and DNA and replication of genomic fragments. Triazavirin is also an effective protective agent on the transmission stage of influenza.
  • HY-N1952
    Isoeugenol

    iso-Eugenol

    Bacterial Infection
    Isoeugenol is an essential oil constituent of nutmeg, clove, and cinnamon. Isoeugenol inhibits growth of Escherichia coli and Listeria innocua with MICs of 0.6 mg/mL and 1 mg/mL, respectively.
  • HY-18564
    HCV-IN-3

    HCV Infection
    HCV-IN-3 is a hepatitis C virus (HCV) NS3/4a protein inhibitor, with an IC50 of 20 μM, a Kd of 29 μM.
  • HY-B0242S2
    Sulfanilamide-d4 hydrochloride

    Sulphanilamide-d4 hydrochloride

    Bacterial Antibiotic Infection
    Sulfanilamide-d4 (Sulphanilamide-d4) hydrochloride is the deuterium labeled Sulfanilamide hydrochloride. Sulfanilamide is a competitive inhibitor for bacterial enzyme dihydropteroate synthetase with IC50 of 320 μM.
  • HY-12983
    ALS-8112

    RSV Infection
    ALS-8112 is a potent and selective respiratory syncytial virus (RSV) polymerase inhibitor. The 5'-triphosphate form of ALS-8112 inhibits RSV polymerase with an IC50 of 0.02 μM.
  • HY-B0454AS
    Miconazole-d5 nitrate (2,4-Dichlorobenzyloxy-d5)

    R18134-d5 nitrate (2,4-Dichlorobenzyloxy-d5)

    Fungal Bacterial Antibiotic Infection
    Miconazole-d5 nitrate (2,4-Dichlorobenzyloxy-d5) is the deuterium labeled Miconazole nitrate. Miconazole nitrate (R18134 nitrate) is an imidazole antifungal agent. Miconazole nitrate also has antibacterial effects.
  • HY-15745A
    PSI-7409 tetrasodium

    HCV Infection
    PSI-7409 tetrasodium is an active 5'-triphosphate metabolite of sofosbuvir (PSI-7977), inhibiting HCV NS5B polymerases, with IC50s of 1.6, 2.8, 0.7 and 2.6 μM for GT 1b_Con1, GT 2a_JFH1, GT 3a, and GT 4a NS5B polymerases, respectively.
  • HY-144259
    Metallo-β-lactamase-IN-2

    Bacterial Infection
    Metallo-β-lactamase-IN-4 (compound 40) is a potent metallo-β-lactamases (MBL) inhibitor, with IC50 values of 0.1 μM (VIM-1), 1.3 μM (NDM-1), and 5.0 μM (IMP-7), respectively.
  • HY-116448
    Metaflumizone

    BAS-320I

    Sodium Channel Parasite Infection
    Metaflumizone is a semicarbazone insecticide, acts as a potent sodium channel blocker.
  • HY-P1568
    Flagelin 22

    Flagellin 22

    Bacterial Infection
    Flagelin 22 (Flagellin 22), a fragment of bacterial flagellin, is an effective elicitor in both plants and algae.
  • HY-W013549S
    6-Aminopenicillanic acid-d3

    6-APA-d3

    Bacterial Infection
    6-Aminopenicillanic acid-d3 (6-APA-d3) is the deuterium labeled 6-Aminopenicillanic acid. 6-Aminopenicillanic acid (6-APA) is an important precursor for the synthesis of -lactam antibiotics. 6-Aminopenicillanic acid is the main product of Penicillin G (PenG) hydrolyzed by penicillin acylase (PA).
  • HY-W268334
    1,2,3,4-Tetrahydronorharman-1-one

    Bacterial Parasite Antibiotic Infection
    1,2,3,4-Tetrahydronorharman-1-one is a manzamine alkaloid with activity against infectious and tropical parasitic diseases from an Indonesian sponge.
  • HY-17373S
    Posaconazole-d5

    SCH 56592-d5

    Fungal Infection
    Posaconazole-D5 is a deuterium-labeled form of Posaconazole. Posaconazole is a broad-spectrum, second generation, triazole compound with antifungal activity.
  • HY-P2454
    CSP1

    Bacterial Infection
    CSP1 is a potent and selective ComD1 receptor agonist, with an IC50 of 10.3 nM. CSP1 is a major variants of competence-stimulating peptide (CSP), and it can regulate genetic transformation of S. pneumonia by modulating quorum sensing (QS). CSP1 can act as an antibacterial agent.
  • HY-100126
    Tubercidin

    7-Deazaadenosine

    Bacterial DNA/RNA Synthesis Influenza Virus Antibiotic Infection
    Tubercidin (7-Deazaadenosine) is an antibiotic obtained from Streptomyces tubercidicus. Tubercidin inhibits the growth of Streptococcus faecalis (8043) with an IC50 of 0.02 μM. Tubercidin inhibits polymerases by incorporating DNA or RNA, thereby inhibiting DNA replication, RNA and protein synthesis. Tubercidin is a weak inhibitor of adenosine phosphorylase, and interferes with the phosphorylation of adenosine and AMP. Tubercidin has antiviral activity.
  • HY-124212
    Thaxtomin A

    Bacterial Infection
    Thaxtomin A is a major phytotoxin produced by S. scabies.
  • HY-B0508S
    Ornidazole-d5

    Ro 7-0207-d5

    Bacterial Parasite Antibiotic Infection
    Ornidazole-d5 is deuterium labeled Ornidazole.
  • HY-N4167
    3-O-Methylgalangin

    Galangin 3-methyl ether; 3-Methylgalangin

    Bacterial Infection
    3-O-Methylgalangin (Galangin 3-methyl ether) is a natural flavonoid compound from the rhizome of Alpinia officinarum (AO) with antibacterial activities, which also inhibits pancreatic lipase.
  • HY-101064S4
    Fmoc-leucine-15N

    SARS-CoV Enterovirus HCV Topoisomerase Infection
    Fmoc-leucine-15N is a 15N-labeled and 13C-labled EIDD-1931. EIDD-1931 (Beta-d-N4-hydroxycytidine; NHC) is a novel nucleoside analog and behaves as a potent anti-virus agent. EIDD-1931 effectively inhibits the replication activity of venezuelan equine ence
  • HY-119821
    Terphenyllin

    Glucosidase Infection
    Terphenyllin is a naturally abundant p-terphenyl metabolite isolated from the coral derived fungus Aspergillus candidus, has significant α-glucosidase inhibitory activity.
  • HY-B0420A
    Moroxydine hydrochloride

    ABOB hydrochloride

    Influenza Virus Infection
    Moroxydine hydrochloride (ABOB hydrochloride) is a synthetic antiviral compound chemically belonging to the series of the heterocyclic biguanidines.
  • HY-N3557
    Cauloside A

    Leontoside A

    Fungal Infection
    Cauloside A (Leontoside A) is a saponin isolated from Dipsacus asper roots. Cauloside A has potent antifungal activity.
  • HY-12651
    Primaquine diphosphate

    Primaquine phosphate; Primaquine bisphosphate

    Parasite Infection
    Primaquine Diphosphate (Primaquine phosphate), an 8-aminoquinoline, exerts a broad spectrum of activities against various stages of parasitic malaria. Primaquine Diphosphate remains as the only agent that destroys late hepatic stages and latent tissue forms of Plasmodium vivax and Plasmodium ovale.
  • HY-16321
    Micafungin sodium

    FK 463 sodium

    Fungal Antibiotic Infection
    Micafungin sodium (FK 463 sodium) is an antifungal agent which inhibits 1, 3-beta-D-glucan synthesis.
  • HY-B2063
    Chlorobenzuron

    Others Infection
    Chlorobenzuron is a chitin synthetase inhibitor, acts as an insecticide. Chlorobenzuron can inhibit larvae development and pupate.
  • HY-100262
    Sulfasymazine

    Bacterial Infection
    Sulfasymazine is a sulfonamide drug and displays antibacterial properties.
  • HY-W010520
    Methylisothiazolinone

    Bacterial Infection
    Methylisothiazolinone is a synthetic biocide and preservative that can be widely used in both industrial and consumer products. Methylisothiazolinone as a preservative in cosmetic and toiletrie products.
  • HY-W074648
    Antibacterial agent 18

    Bacterial Infection
    Antibacterial agent 18 is a multi-arm AIE molecule extracted from patent CN110123801A, compound 23. Antibacterial agent 18 can be used for resisting Gram-positive and Gram-negative bacteria. Antibacterial agent 18 can be conjugated in the cell wall of rigid arm configuration insertion bacterium, and block cell wall turns sugar and turns peptide process, to inhibit or kill bacterium.
  • HY-133609
    3,5-Dichlorocatechol

    Others Infection
    3,5-Dichlorocatechol is a substrate of the broad-spectrum chlorocatechol 1,2-dioxygenase of pseudomonas chlororaphis RW71.
  • HY-P2502
    Hepatitis Virus C NS3 Protease Inhibitor 2

    HCV Protease HCV Infection
    Hepatitis Virus C NS3 Protease Inhibitor 2 is a product-based peptide inhibitor of hepatitis C virus (HCV) NS3 protease, with a Ki of 41 nM.
  • HY-B0334
    Sulbactam

    CP45899

    Bacterial Antibiotic Infection
    Sulbactam (CP45899) is a competitive, irreversible beta-lactamase inhibitor. Sulbactam shows antimicrobial activity against multidrug-resistant (MDR) acinetobacter calcoaceticus--Acinetobacter baumannii (Acb) complex.
  • HY-111817
    ACT-451840

    Parasite Infection
    ACT-451840 is an orally active, potent and low-toxicity compound, showing activity against sensitive and resistant plasmodium falciparum strains. ACT-451840 targets all asexual blood stages of the parasite, has a rapid onset of action. ACT-451840 behaves in a way similar to artemisinin derivatives, with very rapid onset of action and elimination of parasite. ACT-451840 can be used for the research of malarial.
  • HY-W107466
    4-((4-((4-Aminophenyl)sulfonyl)phenyl)amino)-4-oxobutanoic acid

    Others Infection
    4-((4-((4-Aminophenyl)sulfonyl)phenyl)amino)-4-oxobutanoic acid is a sulfonamide antiinfective agent.
  • HY-135666
    DHODH-IN-8

    Parasite Dihydroorotate Dehydrogenase DNA/RNA Synthesis Infection
    DHODH-IN-8 (Compound 27) is an inhibitor of human and Plasmodium falciparum dihydroorotate dehydrogenase (DHODH) with IC50s of 0.13 μM and 47.4 μM, and Kis of 0.016 μM and 5.6 μM, respectively. DHODH-IN-8 has antimalarial activity.
  • HY-139645
    MtDTBS-IN-1

    Others Infection